Incidental Mutation 'R1033:Atp2b2'
ID95252
Institutional Source Beutler Lab
Gene Symbol Atp2b2
Ensembl Gene ENSMUSG00000030302
Gene NameATPase, Ca++ transporting, plasma membrane 2
SynonymsPMCA2, D6Abb2e, wms, jog, Gena300, Tmy
MMRRC Submission 039132-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R1033 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113743831-114042613 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 113793888 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089003] [ENSMUST00000101044] [ENSMUST00000101045] [ENSMUST00000152831] [ENSMUST00000205052]
Predicted Effect probably null
Transcript: ENSMUST00000089003
SMART Domains Protein: ENSMUSP00000086398
Gene: ENSMUSG00000030302

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101044
SMART Domains Protein: ENSMUSP00000098605
Gene: ENSMUSG00000030302

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 307 4.2e-28 PFAM
low complexity region 313 330 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Pfam:E1-E2_ATPase 373 488 1.4e-13 PFAM
Pfam:Hydrolase 493 832 8.1e-16 PFAM
Pfam:HAD 496 829 6.3e-21 PFAM
Pfam:Cation_ATPase 542 638 4.4e-17 PFAM
Pfam:Hydrolase_3 791 865 8.3e-7 PFAM
transmembrane domain 878 900 N/A INTRINSIC
Pfam:Cation_ATPase_C 902 1084 2.5e-47 PFAM
low complexity region 1102 1115 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1126 1178 2.4e-30 PFAM
low complexity region 1196 1211 N/A INTRINSIC
low complexity region 1220 1234 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101045
SMART Domains Protein: ENSMUSP00000098606
Gene: ENSMUSG00000030302

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152831
SMART Domains Protein: ENSMUSP00000138165
Gene: ENSMUSG00000030302

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 6.1e-57 PFAM
Pfam:Hydrolase 448 787 1.4e-25 PFAM
Pfam:HAD 451 784 7.7e-17 PFAM
Pfam:Hydrolase_like2 497 593 4.4e-17 PFAM
Pfam:Hydrolase_3 745 820 4.2e-7 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 2.7e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1149 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204957
Predicted Effect probably null
Transcript: ENSMUST00000205052
SMART Domains Protein: ENSMUSP00000145174
Gene: ENSMUSG00000030302

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 310 1.9e-28 PFAM
Pfam:E1-E2_ATPase 328 443 1.1e-13 PFAM
Pfam:HAD 451 780 2.7e-19 PFAM
Pfam:Cation_ATPase 497 593 5.8e-17 PFAM
Pfam:Hydrolase 576 783 2e-8 PFAM
Pfam:Hydrolase_3 711 816 2.3e-7 PFAM
transmembrane domain 829 851 N/A INTRINSIC
Pfam:Cation_ATPase_C 853 1035 2.5e-47 PFAM
low complexity region 1053 1066 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1077 1129 2.6e-30 PFAM
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G A 1: 26,682,385 P1238L probably benign Het
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Akap6 A C 12: 53,069,222 D1036A probably damaging Het
Alg6 T C 4: 99,762,033 S497P probably benign Het
Arhgap10 T A 8: 77,257,347 I700L possibly damaging Het
Atp11a A G 8: 12,828,555 Y377C probably damaging Het
Card14 T A 11: 119,338,370 V702D probably damaging Het
Ccdc17 C T 4: 116,596,880 R32* probably null Het
Cdh7 A T 1: 110,085,053 D372V probably damaging Het
Cfap54 A T 10: 92,839,449 I2870N probably benign Het
Cped1 G T 6: 22,016,951 V100F probably damaging Het
Dapk1 T C 13: 60,721,865 probably null Het
Exoc4 G A 6: 33,265,987 G45D probably damaging Het
Fam110b A T 4: 5,799,440 N286I probably benign Het
Fbxo10 A T 4: 45,062,236 C97S probably damaging Het
Frem3 A T 8: 80,695,157 H2062L probably benign Het
Frk T C 10: 34,608,458 C476R probably damaging Het
Gm10471 T C 5: 26,089,127 K18E probably benign Het
Gm10542 A G 18: 44,204,601 T49A probably benign Het
Gm128 A G 3: 95,240,011 V324A possibly damaging Het
Gpr141 C T 13: 19,751,710 M298I probably benign Het
Gxylt1 T C 15: 93,245,077 E369G probably benign Het
Hpse2 A G 19: 42,913,199 V368A probably benign Het
Ice1 A T 13: 70,606,594 S458T probably damaging Het
Itgb7 T A 15: 102,223,554 D198V probably damaging Het
Kcnk10 A G 12: 98,518,670 V72A possibly damaging Het
Magel2 A G 7: 62,380,050 M901V unknown Het
Mgam A T 6: 40,680,624 Y971F probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mpp6 T C 6: 50,183,736 Y326H probably damaging Het
Mug1 A T 6: 121,880,551 D1078V probably damaging Het
Myom2 G A 8: 15,108,934 R870H probably benign Het
Nek8 A T 11: 78,171,285 L71Q probably null Het
Nox4 T A 7: 87,374,413 D502E probably damaging Het
Nsmaf G A 4: 6,438,054 P73S probably damaging Het
Nup205 C T 6: 35,227,442 A1421V probably benign Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr1043 A G 2: 86,162,850 I33T possibly damaging Het
Olfr1282 A T 2: 111,335,802 I92N probably damaging Het
Olfr410 A C 11: 74,334,636 N198K possibly damaging Het
Olfr59 A C 11: 74,288,666 T7P probably damaging Het
Prkdc T C 16: 15,767,951 L2451P probably damaging Het
Rad51ap2 C T 12: 11,456,251 S58F probably damaging Het
Rbbp8 A G 18: 11,742,705 R892G probably benign Het
Rock1 A G 18: 10,067,535 S1333P probably benign Het
Rpl7 A G 1: 16,102,504 I197T probably benign Het
Sar1a C A 10: 61,685,616 Q81K probably damaging Het
Shank1 A T 7: 44,356,796 H1979L possibly damaging Het
Slc10a2 C T 8: 5,104,889 V99M probably damaging Het
Slc22a30 G A 19: 8,335,801 Q436* probably null Het
Szt2 C T 4: 118,387,106 R1305H probably damaging Het
Ubash3a G A 17: 31,208,212 G32S probably damaging Het
Vmn1r200 G A 13: 22,395,890 D279N probably damaging Het
Zbtb8a T C 4: 129,354,221 D419G possibly damaging Het
Other mutations in Atp2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Atp2b2 APN 6 113805515 missense possibly damaging 0.69
IGL01140:Atp2b2 APN 6 113789971 missense possibly damaging 0.94
IGL02065:Atp2b2 APN 6 113813867 missense probably damaging 1.00
IGL02267:Atp2b2 APN 6 113793730 missense probably damaging 1.00
IGL02383:Atp2b2 APN 6 113813942 missense probably damaging 0.99
IGL02498:Atp2b2 APN 6 113793854 missense probably damaging 0.99
IGL02631:Atp2b2 APN 6 113748545 missense probably damaging 1.00
IGL03028:Atp2b2 APN 6 113759142 missense probably damaging 0.99
IGL03221:Atp2b2 APN 6 113760859 splice site probably benign
IGL03290:Atp2b2 APN 6 113793754 missense probably damaging 1.00
johan UTSW 6 113773388 missense probably damaging 1.00
lohan UTSW 6 113760650 missense probably damaging 1.00
IGL02799:Atp2b2 UTSW 6 113762852 nonsense probably null
R0116:Atp2b2 UTSW 6 113793695 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0132:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0195:Atp2b2 UTSW 6 113793874 missense probably benign 0.07
R0421:Atp2b2 UTSW 6 113813888 missense probably damaging 1.00
R0791:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R0792:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R1248:Atp2b2 UTSW 6 113817192 missense probably damaging 1.00
R1524:Atp2b2 UTSW 6 113774201 splice site probably benign
R1809:Atp2b2 UTSW 6 113803743 intron probably benign
R1829:Atp2b2 UTSW 6 113773368 missense probably damaging 1.00
R1854:Atp2b2 UTSW 6 113842283 missense probably damaging 1.00
R2127:Atp2b2 UTSW 6 113760650 missense probably damaging 1.00
R2138:Atp2b2 UTSW 6 113796307 missense probably benign 0.21
R2351:Atp2b2 UTSW 6 113789757 missense possibly damaging 0.91
R3923:Atp2b2 UTSW 6 113797108 critical splice donor site probably null
R3951:Atp2b2 UTSW 6 113760831 missense possibly damaging 0.51
R4178:Atp2b2 UTSW 6 113793718 missense probably damaging 1.00
R4353:Atp2b2 UTSW 6 113765784 missense probably benign 0.01
R4578:Atp2b2 UTSW 6 113760711 missense probably damaging 1.00
R4797:Atp2b2 UTSW 6 113789886 missense possibly damaging 0.92
R4884:Atp2b2 UTSW 6 113842186 missense possibly damaging 0.65
R4976:Atp2b2 UTSW 6 113759161 missense probably damaging 1.00
R5273:Atp2b2 UTSW 6 113759232 missense probably damaging 1.00
R5350:Atp2b2 UTSW 6 113759238 missense probably damaging 0.99
R5414:Atp2b2 UTSW 6 113842141 missense probably damaging 1.00
R5560:Atp2b2 UTSW 6 113774358 missense possibly damaging 0.90
R5589:Atp2b2 UTSW 6 113774439 missense possibly damaging 0.94
R5790:Atp2b2 UTSW 6 113759309 missense probably damaging 0.97
R6001:Atp2b2 UTSW 6 113793767 missense probably damaging 1.00
R6127:Atp2b2 UTSW 6 113813877 missense probably damaging 1.00
R6331:Atp2b2 UTSW 6 113797131 missense probably benign 0.01
R6925:Atp2b2 UTSW 6 113760720 missense probably damaging 1.00
R7231:Atp2b2 UTSW 6 113765732 missense possibly damaging 0.89
X0020:Atp2b2 UTSW 6 113805499 missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113805500 missense probably damaging 1.00
Z1088:Atp2b2 UTSW 6 113842306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCACACATTTCGTAGCCCATC -3'
(R):5'- ACTGAGGCTCCCTGAGAAGCAAAG -3'

Sequencing Primer
(F):5'- TTACCTTCACAGAATAGGCCAGTG -3'
(R):5'- ctgagaagcaaagcaaaggac -3'
Posted On2014-01-05