Mutagenetix > Incidental Mutations

Incidental Mutation 'R1208:Atp13a3'

100553

Institutional Source

Beutler Lab

Gene Symbol

Atp13a3

Ensembl Gene

ENSMUSG00000022533

Gene Name

ATPase type 13A3

Synonyms

LOC224088, LOC385637, LOC224087

MMRRC Submission

039277-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.428) question?

Stock #

R1208 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30312423-30405975 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30354247 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 271 (C271S)

Ref Sequence

ENSEMBL: ENSMUSP00000128224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061350] [ENSMUST00000100013]

Predicted Effect

probably benign
Transcript: ENSMUST00000061350
AA Change: C271S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000051645
Gene: ENSMUSG00000022533
AA Change: C271S

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	13	139	4.9e-30	PFAM
Cation_ATPase_N	154	227	7.24e0	SMART
Pfam:E1-E2_ATPase	232	483	5.1e-36	PFAM
Pfam:HAD	491	888	7.5e-28	PFAM
Pfam:Hydrolase_like2	607	661	6.8e-8	PFAM
Pfam:Hydrolase	612	790	6.5e-11	PFAM
transmembrane domain	931	953	N/A	INTRINSIC
transmembrane domain	963	985	N/A	INTRINSIC
transmembrane domain	997	1019	N/A	INTRINSIC
transmembrane domain	1068	1085	N/A	INTRINSIC
transmembrane domain	1098	1120	N/A	INTRINSIC
transmembrane domain	1135	1153	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100013
AA Change: C271S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000128224
Gene: ENSMUSG00000022533
AA Change: C271S

Domain	Start	End	E-Value	Type
Pfam:P5-ATPase	13	146	2.9e-38	PFAM
Cation_ATPase_N	154	227	7.24e0	SMART
Pfam:E1-E2_ATPase	232	483	7.3e-41	PFAM
Pfam:Hydrolase	488	784	1.3e-12	PFAM
Pfam:HAD	491	888	1.3e-31	PFAM
Pfam:Cation_ATPase	612	660	4.5e-7	PFAM
transmembrane domain	931	953	N/A	INTRINSIC
transmembrane domain	963	985	N/A	INTRINSIC
transmembrane domain	997	1019	N/A	INTRINSIC
transmembrane domain	1068	1085	N/A	INTRINSIC
transmembrane domain	1098	1120	N/A	INTRINSIC
transmembrane domain	1135	1157	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149882

Coding Region Coverage

1x: 99.3%
3x: 97.8%
10x: 91.7%
20x: 74.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP13A3 is a member of the P-type ATPase family of proteins that transport a variety of cations across membranes. Other P-type ATPases include ATP7B (MIM 606882) and ATP7A (MIM 300011).[supplied by OMIM, Aug 2008]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccl25	T	A	8: 4,357,631	S199T	possibly damaging	Het
Cdh15	G	C	8: 122,857,495	E112Q	probably damaging	Het
Cep104	A	T	4: 153,985,379	D270V	probably damaging	Het
Dnah5	T	A	15: 28,327,731	Y2084N	probably damaging	Het
Eftud2	A	G	11: 102,864,766	V214A	probably benign	Het
Epb41l4b	C	T	4: 57,077,252		probably null	Het
Fam129c	A	T	8: 71,600,475	T125S	probably damaging	Het
Gm8298	C	T	3: 59,865,294	P73L	probably benign	Het
Golgb1	AAGAGAGAGAGAGAGA	AAGAGAGAGAGAGA	16: 36,915,205		probably null	Het
Gys2	A	G	6: 142,450,467		probably null	Het
Lig4	T	C	8: 9,971,062	E906G	probably damaging	Het
Mast3	G	A	8: 70,788,272		probably null	Het
Mta2	G	A	19: 8,951,017	R560H	probably damaging	Het
Myom2	T	C	8: 15,084,631	L478P	probably damaging	Het
Neb	A	T	2: 52,303,900	L673*	probably null	Het
Olfr1260	G	A	2: 89,978,492	C238Y	probably damaging	Het
Pdpk1	C	A	17: 24,093,609		probably null	Het
Perm1	T	C	4: 156,217,002	M1T	probably null	Het
Pphln1	T	C	15: 93,459,729	W162R	probably damaging	Het
Ppp1r13b	A	G	12: 111,844,905	V183A	probably damaging	Het
Recql5	T	C	11: 115,893,156	K951E	probably damaging	Het
Slc25a25	T	C	2: 32,417,425	E309G	probably benign	Het
Sycp2	A	T	2: 178,356,628	I1033N	possibly damaging	Het
Tbpl2	A	T	2: 24,094,771	N120K	probably benign	Het
Unc5b	A	T	10: 60,766,992	L876Q	probably damaging	Het
Usp9y	T	C	Y: 1,356,282	T1140A	probably benign	Het
Vmn1r40	A	G	6: 89,714,344	I48V	probably benign	Het
Zbbx	T	C	3: 75,037,992	I708V	possibly damaging	Het
Zfp318	AGAAGA	AGAAGAGGAAGA	17: 46,412,520		probably benign	Het

Other mutations in Atp13a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Atp13a3	APN	16	30351279	missense	probably damaging	0.99
IGL00490:Atp13a3	APN	16	30352354	missense	probably benign	0.31
IGL01844:Atp13a3	APN	16	30361963	missense	probably benign	0.17
IGL01994:Atp13a3	APN	16	30337518	missense	possibly damaging	0.90
IGL02057:Atp13a3	APN	16	30332364	missense	probably benign
IGL02083:Atp13a3	APN	16	30347706	missense	possibly damaging	0.89
IGL02348:Atp13a3	APN	16	30351228	critical splice donor site	probably null
IGL02352:Atp13a3	APN	16	30351084	missense	probably damaging	1.00
IGL02359:Atp13a3	APN	16	30351084	missense	probably damaging	1.00
IGL02643:Atp13a3	APN	16	30333796	missense	probably null
IGL02687:Atp13a3	APN	16	30337551	missense	probably damaging	1.00
IGL02951:Atp13a3	APN	16	30338621	splice site	probably null
IGL03190:Atp13a3	APN	16	30322948	missense	probably benign	0.00
H8562:Atp13a3	UTSW	16	30359725	nonsense	probably null
H8786:Atp13a3	UTSW	16	30359725	nonsense	probably null
PIT4812001:Atp13a3	UTSW	16	30362578	missense	probably damaging	0.98
R0725:Atp13a3	UTSW	16	30351387	missense	probably damaging	1.00
R1208:Atp13a3	UTSW	16	30354247	missense	probably benign	0.21
R1244:Atp13a3	UTSW	16	30361836	missense	probably benign	0.00
R1326:Atp13a3	UTSW	16	30352310	missense	probably damaging	1.00
R1613:Atp13a3	UTSW	16	30332300	missense	probably damaging	1.00
R1672:Atp13a3	UTSW	16	30332274	missense	possibly damaging	0.96
R1709:Atp13a3	UTSW	16	30315841	missense	probably benign	0.37
R1733:Atp13a3	UTSW	16	30357266	missense	probably benign	0.35
R2086:Atp13a3	UTSW	16	30352298	missense	possibly damaging	0.89
R2128:Atp13a3	UTSW	16	30354276	missense	probably damaging	0.97
R2421:Atp13a3	UTSW	16	30349825	missense	probably benign	0.29
R3427:Atp13a3	UTSW	16	30344593	missense	probably benign	0.05
R3783:Atp13a3	UTSW	16	30354249	missense	probably damaging	1.00
R4058:Atp13a3	UTSW	16	30354246	missense	possibly damaging	0.94
R4059:Atp13a3	UTSW	16	30354246	missense	possibly damaging	0.94
R4798:Atp13a3	UTSW	16	30341240	missense	probably damaging	1.00
R5045:Atp13a3	UTSW	16	30339876	missense	probably benign	0.24
R5216:Atp13a3	UTSW	16	30340284	missense	probably damaging	1.00
R5704:Atp13a3	UTSW	16	30321879	missense	probably benign	0.18
R5876:Atp13a3	UTSW	16	30362734	missense	probably benign	0.13
R5947:Atp13a3	UTSW	16	30362700	missense	probably benign	0.01
R6291:Atp13a3	UTSW	16	30336243	missense	probably damaging	0.99
R6324:Atp13a3	UTSW	16	30332285	missense	possibly damaging	0.72
R6328:Atp13a3	UTSW	16	30336235	missense	probably damaging	0.99
R6372:Atp13a3	UTSW	16	30343455	missense	probably damaging	0.99
R6446:Atp13a3	UTSW	16	30361869	missense	probably benign	0.00
R7016:Atp13a3	UTSW	16	30338490	missense	possibly damaging	0.54
R7086:Atp13a3	UTSW	16	30351063	missense	possibly damaging	0.87
R7241:Atp13a3	UTSW	16	30352277	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GTCATGCCTTCAGTCTTACTCCCTGATA -3'
(R):5'- TGCCCAGAGGACCCAGTTTGATA -3'

Sequencing Primer
(F):5'- cttactccctgataaaccaggac -3'
(R):5'- CCCCCAGCAATATGTTATGTTAC -3'

Posted On

2014-01-15