Incidental Mutation 'H8786:Atp13a3'
ID44476
Institutional Source Beutler Lab
Gene Symbol Atp13a3
Ensembl Gene ENSMUSG00000022533
Gene NameATPase type 13A3
SynonymsLOC224088, LOC385637, LOC224087
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #H8786 (G3) of strain 617
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location30312423-30405975 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 30359725 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 164 (C164*)
Ref Sequence ENSEMBL: ENSMUSP00000128224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061350] [ENSMUST00000100013] [ENSMUST00000229616]
Predicted Effect probably null
Transcript: ENSMUST00000061350
AA Change: C164*
SMART Domains Protein: ENSMUSP00000051645
Gene: ENSMUSG00000022533
AA Change: C164*

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 139 4.9e-30 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 5.1e-36 PFAM
Pfam:HAD 491 888 7.5e-28 PFAM
Pfam:Hydrolase_like2 607 661 6.8e-8 PFAM
Pfam:Hydrolase 612 790 6.5e-11 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1153 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100013
AA Change: C164*
SMART Domains Protein: ENSMUSP00000128224
Gene: ENSMUSG00000022533
AA Change: C164*

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 146 2.9e-38 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 7.3e-41 PFAM
Pfam:Hydrolase 488 784 1.3e-12 PFAM
Pfam:HAD 491 888 1.3e-31 PFAM
Pfam:Cation_ATPase 612 660 4.5e-7 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1157 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153656
Predicted Effect probably benign
Transcript: ENSMUST00000229616
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP13A3 is a member of the P-type ATPase family of proteins that transport a variety of cations across membranes. Other P-type ATPases include ATP7B (MIM 606882) and ATP7A (MIM 300011).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,494,094 Y363H probably benign Het
4933402N03Rik T A 7: 131,139,177 R103S probably damaging Het
Aars A G 8: 111,045,555 D459G probably benign Het
Adam25 A T 8: 40,754,224 M176L probably benign Het
Adcy5 A G 16: 35,267,181 I471V probably damaging Het
Ano8 A T 8: 71,478,744 probably benign Het
Arhgef28 T A 13: 97,946,953 Q1136L probably damaging Het
Avl9 G A 6: 56,757,310 A625T probably damaging Het
Avpr1a A T 10: 122,449,468 M222L probably benign Het
B4galnt4 A T 7: 141,071,322 M939L probably damaging Het
B4galt6 A G 18: 20,688,944 F331S probably benign Het
C2cd2 G T 16: 97,879,640 Q325K possibly damaging Het
Caml T G 13: 55,628,596 L216R probably damaging Het
Cd200r4 A G 16: 44,833,373 T132A possibly damaging Het
Ces1h A C 8: 93,362,922 V283G probably damaging Het
Clptm1 A T 7: 19,635,704 V427D possibly damaging Het
Drd1 T A 13: 54,053,103 N357I possibly damaging Het
Foxq1 C G 13: 31,559,458 S181W probably damaging Het
Gfra2 C T 14: 70,978,378 T169M possibly damaging Het
Gm42542 T C 6: 68,895,650 probably null Het
Hoxa13 CGG CGNGG 6: 52,260,636 probably null Het
Hsd11b1 C A 1: 193,240,252 A166S probably benign Het
Kcnab3 T A 11: 69,328,267 F101L probably damaging Het
Klf6 C A 13: 5,861,791 H51Q probably damaging Het
Krtap4-8 G A 11: 99,780,072 P191L unknown Het
Lrrk2 T A 15: 91,673,358 N26K probably benign Het
Mrgprd T C 7: 145,322,267 S292P probably benign Het
Ms4a8a A G 19: 11,076,361 I127T possibly damaging Het
Myo7a T G 7: 98,095,778 N280T possibly damaging Het
Nipal4 A G 11: 46,150,477 F297S probably damaging Het
Npas1 A G 7: 16,461,350 I351T possibly damaging Het
Olfr1245 C A 2: 89,575,279 G149V probably damaging Het
Olfr311 A T 11: 58,841,320 I69F probably benign Het
Olfr360 A G 2: 37,068,329 E8G probably benign Het
Parp11 A G 6: 127,471,635 T72A probably damaging Het
Pik3c3 T C 18: 30,294,343 V300A probably damaging Het
Pik3cb T C 9: 99,046,559 E881G possibly damaging Het
Polr2h T A 16: 20,720,531 L57* probably null Het
Rela T A 19: 5,647,018 S418T probably benign Het
Rptn A G 3: 93,397,873 T838A possibly damaging Het
Sez6l2 T A 7: 126,961,783 N413K possibly damaging Het
Slc6a2 A G 8: 92,994,640 I466V probably benign Het
Slco4c1 A T 1: 96,841,151 C329S probably damaging Het
Sppl2c A G 11: 104,186,865 M164V probably benign Het
Spta1 G A 1: 174,179,839 V212M probably damaging Het
Sqor A C 2: 122,792,368 I142L probably benign Het
Suco T C 1: 161,852,851 E317G probably damaging Het
Tlk2 T A 11: 105,254,979 I337N possibly damaging Het
Tln1 A T 4: 43,544,589 N1113K probably damaging Het
Tmc2 A G 2: 130,226,262 Y234C probably damaging Het
Tmem167 A C 13: 90,098,466 K36N probably damaging Het
Trim72 T C 7: 128,004,791 L103P probably damaging Het
Urb1 T A 16: 90,769,469 M1477L probably benign Het
Vwa2 T A 19: 56,909,732 M721K possibly damaging Het
Zcchc11 T C 4: 108,550,815 probably null Het
Zfp143 T G 7: 110,094,368 D636E probably damaging Het
Other mutations in Atp13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Atp13a3 APN 16 30351279 missense probably damaging 0.99
IGL00490:Atp13a3 APN 16 30352354 missense probably benign 0.31
IGL01844:Atp13a3 APN 16 30361963 missense probably benign 0.17
IGL01994:Atp13a3 APN 16 30337518 missense possibly damaging 0.90
IGL02057:Atp13a3 APN 16 30332364 missense probably benign
IGL02083:Atp13a3 APN 16 30347706 missense possibly damaging 0.89
IGL02348:Atp13a3 APN 16 30351228 critical splice donor site probably null
IGL02352:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02359:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02643:Atp13a3 APN 16 30333796 missense probably null
IGL02687:Atp13a3 APN 16 30337551 missense probably damaging 1.00
IGL02951:Atp13a3 APN 16 30338621 splice site probably null
IGL03190:Atp13a3 APN 16 30322948 missense probably benign 0.00
H8562:Atp13a3 UTSW 16 30359725 nonsense probably null
PIT4812001:Atp13a3 UTSW 16 30362578 missense probably damaging 0.98
R0725:Atp13a3 UTSW 16 30351387 missense probably damaging 1.00
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1244:Atp13a3 UTSW 16 30361836 missense probably benign 0.00
R1326:Atp13a3 UTSW 16 30352310 missense probably damaging 1.00
R1613:Atp13a3 UTSW 16 30332300 missense probably damaging 1.00
R1672:Atp13a3 UTSW 16 30332274 missense possibly damaging 0.96
R1709:Atp13a3 UTSW 16 30315841 missense probably benign 0.37
R1733:Atp13a3 UTSW 16 30357266 missense probably benign 0.35
R2086:Atp13a3 UTSW 16 30352298 missense possibly damaging 0.89
R2128:Atp13a3 UTSW 16 30354276 missense probably damaging 0.97
R2421:Atp13a3 UTSW 16 30349825 missense probably benign 0.29
R3427:Atp13a3 UTSW 16 30344593 missense probably benign 0.05
R3783:Atp13a3 UTSW 16 30354249 missense probably damaging 1.00
R4058:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4059:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4798:Atp13a3 UTSW 16 30341240 missense probably damaging 1.00
R5045:Atp13a3 UTSW 16 30339876 missense probably benign 0.24
R5216:Atp13a3 UTSW 16 30340284 missense probably damaging 1.00
R5704:Atp13a3 UTSW 16 30321879 missense probably benign 0.18
R5876:Atp13a3 UTSW 16 30362734 missense probably benign 0.13
R5947:Atp13a3 UTSW 16 30362700 missense probably benign 0.01
R6291:Atp13a3 UTSW 16 30336243 missense probably damaging 0.99
R6324:Atp13a3 UTSW 16 30332285 missense possibly damaging 0.72
R6328:Atp13a3 UTSW 16 30336235 missense probably damaging 0.99
R6372:Atp13a3 UTSW 16 30343455 missense probably damaging 0.99
R6446:Atp13a3 UTSW 16 30361869 missense probably benign 0.00
R7016:Atp13a3 UTSW 16 30338490 missense possibly damaging 0.54
R7086:Atp13a3 UTSW 16 30351063 missense possibly damaging 0.87
R7241:Atp13a3 UTSW 16 30352277 missense possibly damaging 0.93
R7589:Atp13a3 UTSW 16 30344615 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCACTATGTGAGACTGACAGGACG -3'
(R):5'- AGGACTTATTGGTGCAACTTGTGGAAG -3'

Sequencing Primer
(F):5'- tctacccaatacacaacacatcc -3'
(R):5'- GTTGACTCATAAGCTTTGGAAACTG -3'
Posted On2013-06-11