Incidental Mutation 'R1292:Cma2'
ID150826
Institutional Source Beutler Lab
Gene Symbol Cma2
Ensembl Gene ENSMUSG00000068289
Gene Namechymase 2, mast cell
Synonyms
MMRRC Submission 039358-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1292 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55950980-55974031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55973742 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 164 (R164C)
Ref Sequence ENSEMBL: ENSMUSP00000154424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089555] [ENSMUST00000228263]
Predicted Effect probably damaging
Transcript: ENSMUST00000089555
AA Change: R220C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086984
Gene: ENSMUSG00000068289
AA Change: R220C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 239 7.12e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228263
AA Change: R164C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik T A 9: 53,425,619 D74E probably benign Het
9530053A07Rik A C 7: 28,142,794 probably benign Het
Abcb1a A T 5: 8,713,343 T624S probably benign Het
Atp8b1 T C 18: 64,571,021 Y342C probably damaging Het
Clcnka A G 4: 141,395,592 probably benign Het
Cnga1 T C 5: 72,604,683 D496G probably damaging Het
Ctbp2 T A 7: 133,015,189 R6W probably damaging Het
Cyp3a11 T C 5: 145,865,994 T230A probably benign Het
Defb40 A C 8: 18,978,064 I18S probably benign Het
Gm10036 T G 18: 15,833,311 I173S possibly damaging Het
Herc2 A T 7: 56,197,203 I3634L probably benign Het
Igfbp1 A G 11: 7,200,863 N218S probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kmt2a A T 9: 44,814,694 probably benign Het
Ly9 T C 1: 171,589,103 probably null Het
Mut C A 17: 40,941,407 A280E probably damaging Het
Olfr180 C T 16: 58,915,771 R290K probably damaging Het
Olfr231 A G 1: 174,117,854 F54S probably benign Het
Pcdhb13 T C 18: 37,443,832 V421A probably benign Het
Pik3ca T A 3: 32,454,420 L779Q probably damaging Het
Plxnd1 T C 6: 115,962,683 probably benign Het
Prss16 T A 13: 22,009,521 K35* probably null Het
Rhbdl2 G A 4: 123,829,642 A280T possibly damaging Het
Slc2a2 C T 3: 28,717,488 T189I probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tacr1 A G 6: 82,554,875 I251V probably damaging Het
Tln1 A G 4: 43,534,578 probably null Het
Vdac3-ps1 T C 13: 18,031,295 noncoding transcript Het
Zfp458 A T 13: 67,256,690 C562S probably damaging Het
Other mutations in Cma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Cma2 APN 14 55973737 missense probably benign 0.00
IGL03139:Cma2 APN 14 55973799 missense probably damaging 1.00
R0411:Cma2 UTSW 14 55973678 splice site probably benign
R0545:Cma2 UTSW 14 55973113 missense probably benign 0.01
R0558:Cma2 UTSW 14 55972792 missense probably damaging 1.00
R1187:Cma2 UTSW 14 55972823 missense probably benign 0.07
R1371:Cma2 UTSW 14 55972826 missense probably damaging 1.00
R1575:Cma2 UTSW 14 55972815 missense probably damaging 1.00
R1662:Cma2 UTSW 14 55973116 missense probably damaging 1.00
R5198:Cma2 UTSW 14 55972075 missense probably benign 0.03
R5601:Cma2 UTSW 14 55973789 missense possibly damaging 0.86
R6222:Cma2 UTSW 14 55973192 missense possibly damaging 0.90
R6505:Cma2 UTSW 14 55973779 missense probably damaging 1.00
R7387:Cma2 UTSW 14 55973048 missense probably benign 0.03
R8222:Cma2 UTSW 14 55973270 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGGAGCCTGGAACCCTTACTAC -3'
(R):5'- CTGAGGTGCATTACAGGGAACAGTC -3'

Sequencing Primer
(F):5'- TGGGGGAATGTGATCTATGCTC -3'
(R):5'- tggggacagactggggg -3'
Posted On2014-01-29