Incidental Mutation 'R1370:Olfr198'
ID155974
Institutional Source Beutler Lab
Gene Symbol Olfr198
Ensembl Gene ENSMUSG00000052537
Gene Nameolfactory receptor 198
SynonymsGA_x54KRFPKG5P-55416332-55415412, MOR182-8
MMRRC Submission 039434-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1370 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59200352-59203533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59201680 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000146813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064452] [ENSMUST00000208244]
Predicted Effect probably damaging
Transcript: ENSMUST00000064452
AA Change: S249P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065535
Gene: ENSMUSG00000052537
AA Change: S249P

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.9e-45 PFAM
Pfam:7tm_1 41 290 4.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208244
AA Change: S249P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Adgra3 T C 5: 49,960,787 I1140V possibly damaging Het
Adrb3 A T 8: 27,227,770 probably null Het
Afap1 A G 5: 35,935,600 D16G unknown Het
AI593442 T C 9: 52,678,008 K90E probably damaging Het
Aicda A T 6: 122,561,185 N101Y probably benign Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
Bin1 A G 18: 32,429,703 I416V probably benign Het
Bptf A T 11: 107,047,094 S2724T probably damaging Het
Brf1 A T 12: 112,961,108 probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cdan1 A G 2: 120,719,139 probably null Het
Chaf1a A T 17: 56,064,032 H639L probably benign Het
Chd1 G A 17: 17,387,480 G430D probably benign Het
Clca3a2 T C 3: 144,813,863 probably benign Het
Clptm1 A G 7: 19,633,872 V605A possibly damaging Het
Cmpk2 A G 12: 26,471,452 D241G probably damaging Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dennd4c T A 4: 86,811,510 I783N probably damaging Het
Dock10 A G 1: 80,540,343 S1305P probably damaging Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Gbp8 C T 5: 105,016,576 A394T possibly damaging Het
Gm13023 T A 4: 143,795,304 L497I possibly damaging Het
H1fx A G 6: 87,981,151 I69T probably damaging Het
Herc2 T A 7: 56,168,873 C2771S probably benign Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Klk11 A G 7: 43,776,907 I22V probably benign Het
Krt6b T C 15: 101,677,552 D362G probably damaging Het
Lce1e A G 3: 92,707,843 S66P unknown Het
Letm1 A T 5: 33,778,682 probably null Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Mrpl12 A G 11: 120,485,301 S46G probably benign Het
Narfl A G 17: 25,776,988 E62G probably benign Het
Ndrg3 T C 2: 156,938,650 E198G probably damaging Het
Pcdh20 A G 14: 88,468,301 I521T probably benign Het
Pdzph1 T C 17: 58,974,087 D400G possibly damaging Het
Per2 A T 1: 91,445,557 S170T possibly damaging Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rerg A T 6: 137,057,801 probably benign Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Sept2 G T 1: 93,499,106 V146L probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Sh3bp4 A T 1: 89,143,772 Y114F probably benign Het
Slc44a5 C A 3: 154,243,159 T188K probably benign Het
Slco6d1 A C 1: 98,423,094 I100L probably benign Het
Slfn4 G T 11: 83,188,806 D441Y probably damaging Het
Smg1 T C 7: 118,159,752 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Stard9 T C 2: 120,697,477 V1405A probably benign Het
Syt1 A G 10: 108,690,922 L42P probably damaging Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tbcel A T 9: 42,450,062 D63E probably damaging Het
Tdrd3 A T 14: 87,458,054 probably benign Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Tsc22d1 A G 14: 76,437,664 probably benign Het
Tsga10 G T 1: 37,835,453 T117K probably damaging Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Ttn G T 2: 76,847,151 probably benign Het
Wasf3 T C 5: 146,470,208 probably benign Het
Zbtb37 C T 1: 161,032,022 E238K probably benign Het
Zfp354c A G 11: 50,815,840 I136T probably benign Het
Zfp384 G A 6: 125,036,453 A479T probably benign Het
Zfp646 T A 7: 127,879,864 N404K probably damaging Het
Other mutations in Olfr198
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Olfr198 APN 16 59202097 missense possibly damaging 0.94
IGL03053:Olfr198 APN 16 59202247 missense probably damaging 1.00
IGL03168:Olfr198 APN 16 59202247 missense probably damaging 1.00
R1355:Olfr198 UTSW 16 59201680 missense probably damaging 1.00
R1510:Olfr198 UTSW 16 59202183 missense probably damaging 0.99
R1777:Olfr198 UTSW 16 59202016 missense probably benign 0.35
R1962:Olfr198 UTSW 16 59201908 missense possibly damaging 0.88
R1964:Olfr198 UTSW 16 59201908 missense possibly damaging 0.88
R5409:Olfr198 UTSW 16 59201557 missense probably damaging 1.00
R5642:Olfr198 UTSW 16 59202006 missense probably damaging 1.00
R5704:Olfr198 UTSW 16 59202006 missense probably damaging 1.00
R6323:Olfr198 UTSW 16 59202282 missense probably damaging 1.00
R6829:Olfr198 UTSW 16 59201535 missense probably damaging 1.00
R7315:Olfr198 UTSW 16 59202133 missense probably benign 0.00
R7738:Olfr198 UTSW 16 59201955 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGAGATGCTCACTGCCTTCAAC -3'
(R):5'- TGCACTGATCCTACAATGAACGTCC -3'

Sequencing Primer
(F):5'- CATGAGCTACTGGTGACCTG -3'
(R):5'- GATCCTACAATGAACGTCCTTCTG -3'
Posted On2014-02-11