Incidental Mutation 'R1336:Papss2'
ID156887
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission 039401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1336 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32638315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 149 (V149A)
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025833
AA Change: V149A

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899
AA Change: V149A

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asah2 A G 19: 32,044,941 I231T probably damaging Het
Bbs7 A G 3: 36,604,444 I227T probably benign Het
Ccdc141 T C 2: 77,014,440 T1428A probably damaging Het
Chsy1 C A 7: 66,125,239 probably null Het
Cox16 T C 12: 81,472,290 D89G probably damaging Het
Dnah17 A G 11: 118,043,215 I3511T possibly damaging Het
Dpy19l4 A T 4: 11,276,901 Y333N probably damaging Het
Fcrl6 G A 1: 172,599,224 Q52* probably null Het
Fgl2 T A 5: 21,373,183 L156Q possibly damaging Het
Fras1 A G 5: 96,707,308 D1892G probably benign Het
Ogfod1 T C 8: 94,058,099 C344R probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pmfbp1 T G 8: 109,530,266 I534S probably damaging Het
Rif1 T A 2: 52,078,314 W170R probably benign Het
Ros1 G A 10: 52,168,662 T183I probably damaging Het
Snx4 T C 16: 33,280,680 I234T probably benign Het
Sptbn4 A G 7: 27,417,963 S454P probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Uck1 T C 2: 32,259,654 D71G probably damaging Het
Vcan C T 13: 89,693,055 E497K probably damaging Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R0708:Papss2 UTSW 19 32637216 missense probably damaging 0.97
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4369:Papss2 UTSW 19 32641391 missense probably damaging 1.00
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5235:Papss2 UTSW 19 32639219 missense probably benign 0.00
R5294:Papss2 UTSW 19 32639000 missense probably benign 0.03
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32651942 synonymous probably null
R7055:Papss2 UTSW 19 32664427 missense probably damaging 1.00
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTGCCTATGAGAGGGACATCTCTG -3'
(R):5'- ATCCTAAAAGGCCACGACCATTCTG -3'

Sequencing Primer
(F):5'- gcacttttgttgactgataagaacc -3'
(R):5'- TTCTGAACACACTGAGCGTG -3'
Posted On2014-02-11