Incidental Mutation 'R1185:Muc19'
ID 165268
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Name mucin 19
Synonyms sld, apomucin
MMRRC Submission 039257-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.182) question?
Stock # R1185 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 91722531-91832440 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) A to G at 91762743 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178108
SMART Domains Protein: ENSMUSP00000136475
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
VWD 30 181 1.31e-13 SMART
Pfam:C8 200 277 2.5e-8 PFAM
Pfam:TIL 281 336 7.5e-12 PFAM
Pfam:VWD 377 477 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.3%
  • 10x: 93.0%
  • 20x: 79.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ac165356.1 C T 7: 105,682,686 (GRCm39) A190T probably benign Het
Aimp2 A G 5: 143,841,509 (GRCm39) S110P possibly damaging Het
Akap9 A G 5: 3,998,783 (GRCm39) T51A probably benign Het
Arhgef25 A G 10: 127,019,650 (GRCm39) F430L possibly damaging Het
Brap T C 5: 121,813,342 (GRCm39) V235A probably damaging Het
Cd69 C T 6: 129,247,148 (GRCm39) G23D probably damaging Het
Cecr2 C T 6: 120,735,166 (GRCm39) R24* probably null Het
Celsr2 T C 3: 108,307,025 (GRCm39) D1974G possibly damaging Het
Cps1 A G 1: 67,234,358 (GRCm39) K915R probably benign Het
Csmd1 T C 8: 16,408,362 (GRCm39) D401G probably damaging Het
Dusp13b A G 14: 21,785,086 (GRCm39) F141S probably damaging Het
Eif1ad19 A G 12: 87,740,478 (GRCm39) V27A probably benign Het
Fam162b A G 10: 51,466,439 (GRCm39) W27R probably benign Het
Focad A G 4: 88,096,424 (GRCm39) T269A probably benign Het
Ghr T A 15: 3,357,544 (GRCm39) R241S possibly damaging Het
Hirip3 AAGAG AAG 7: 126,462,832 (GRCm39) probably null Het
Itgb2l A G 16: 96,230,240 (GRCm39) Y357H possibly damaging Het
Jrkl T C 9: 13,244,938 (GRCm39) D241G possibly damaging Het
Lmod1 A G 1: 135,291,967 (GRCm39) D274G probably benign Het
Lrrn2 A G 1: 132,866,959 (GRCm39) S675G probably benign Het
Ltbp4 G C 7: 27,009,960 (GRCm39) P1200R probably damaging Het
Mdn1 T C 4: 32,735,576 (GRCm39) L3414P possibly damaging Het
Neb A G 2: 52,186,310 (GRCm39) Y921H probably damaging Het
Or2n1c T A 17: 38,520,074 (GRCm39) *313R probably null Het
Pgap3 T C 11: 98,281,960 (GRCm39) D117G probably damaging Het
Ppp1r9b T C 11: 94,892,812 (GRCm39) F671L possibly damaging Het
Purg T G 8: 33,876,897 (GRCm39) Y178* probably null Het
Rsph10b G A 5: 143,903,280 (GRCm39) probably benign Het
Sorbs1 T A 19: 40,371,050 (GRCm39) D79V probably damaging Het
Tcaf3 T C 6: 42,568,368 (GRCm39) T663A probably damaging Het
Timd4 C A 11: 46,708,475 (GRCm39) T167K probably damaging Het
Tjp2 A G 19: 24,108,527 (GRCm39) L195P possibly damaging Het
Tnr G A 1: 159,679,856 (GRCm39) A277T probably benign Het
Trpm3 G A 19: 22,891,781 (GRCm39) probably benign Het
Unc13a C T 8: 72,114,477 (GRCm39) G181D probably benign Het
Vmn1r11 T A 6: 57,114,492 (GRCm39) L52Q possibly damaging Het
Vmn2r125 C A 4: 156,703,396 (GRCm39) A258D probably benign Het
Zfp27 T C 7: 29,595,254 (GRCm39) D237G possibly damaging Het
Zfp39 T C 11: 58,793,670 (GRCm39) T23A possibly damaging Het
Zfp459 T G 13: 67,556,600 (GRCm39) N161T probably benign Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91,770,943 (GRCm39) exon noncoding transcript
IGL01017:Muc19 APN 15 91,764,901 (GRCm39) exon noncoding transcript
IGL01140:Muc19 APN 15 91,783,593 (GRCm39) exon noncoding transcript
IGL01292:Muc19 APN 15 91,778,470 (GRCm39) exon noncoding transcript
IGL01397:Muc19 APN 15 91,778,498 (GRCm39) exon noncoding transcript
IGL01525:Muc19 APN 15 91,770,877 (GRCm39) exon noncoding transcript
IGL01589:Muc19 APN 15 91,754,699 (GRCm39) exon noncoding transcript
IGL02023:Muc19 APN 15 91,772,453 (GRCm39) exon noncoding transcript
IGL02088:Muc19 APN 15 91,775,362 (GRCm39) splice site noncoding transcript
IGL02168:Muc19 APN 15 91,778,292 (GRCm39) exon noncoding transcript
IGL02343:Muc19 APN 15 91,778,428 (GRCm39) exon noncoding transcript
IGL02402:Muc19 APN 15 91,778,192 (GRCm39) splice site noncoding transcript
IGL02433:Muc19 APN 15 91,756,694 (GRCm39) exon noncoding transcript
IGL02533:Muc19 APN 15 91,782,241 (GRCm39) exon noncoding transcript
IGL02558:Muc19 APN 15 91,781,816 (GRCm39) exon noncoding transcript
IGL02652:Muc19 APN 15 91,762,009 (GRCm39) critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91,808,424 (GRCm39) unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91,766,850 (GRCm39) exon noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0208:Muc19 UTSW 15 91,777,218 (GRCm39) splice site noncoding transcript
R0597:Muc19 UTSW 15 91,784,696 (GRCm39) splice site noncoding transcript
R1185:Muc19 UTSW 15 91,762,743 (GRCm39) exon noncoding transcript
R1469:Muc19 UTSW 15 91,758,498 (GRCm39) unclassified noncoding transcript
R1942:Muc19 UTSW 15 91,776,666 (GRCm39) exon noncoding transcript
R2035:Muc19 UTSW 15 91,776,599 (GRCm39) splice site noncoding transcript
R2208:Muc19 UTSW 15 91,755,747 (GRCm39) exon noncoding transcript
R2877:Muc19 UTSW 15 91,777,200 (GRCm39) exon noncoding transcript
R2897:Muc19 UTSW 15 91,822,550 (GRCm39) critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91,781,816 (GRCm39) exon noncoding transcript
R4403:Muc19 UTSW 15 91,755,768 (GRCm39) exon noncoding transcript
R4606:Muc19 UTSW 15 91,832,268 (GRCm39) exon noncoding transcript
R4677:Muc19 UTSW 15 91,772,411 (GRCm39) exon noncoding transcript
R4753:Muc19 UTSW 15 91,761,955 (GRCm39) unclassified noncoding transcript
R4781:Muc19 UTSW 15 91,787,360 (GRCm39) critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91,781,910 (GRCm39) exon noncoding transcript
R5000:Muc19 UTSW 15 91,757,429 (GRCm39) unclassified noncoding transcript
R5044:Muc19 UTSW 15 91,772,332 (GRCm39) exon noncoding transcript
R5156:Muc19 UTSW 15 91,784,614 (GRCm39) exon noncoding transcript
R5176:Muc19 UTSW 15 91,776,374 (GRCm39) exon noncoding transcript
R5224:Muc19 UTSW 15 91,825,910 (GRCm39) exon noncoding transcript
R5524:Muc19 UTSW 15 91,778,587 (GRCm39) exon noncoding transcript
R5568:Muc19 UTSW 15 91,768,468 (GRCm39) splice site noncoding transcript
R5592:Muc19 UTSW 15 91,828,199 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ACCCATTTGAAAGGACTGCTGGAG -3'
(R):5'- AAGCGAGTGTAAGTGTGCCCTG -3'

Sequencing Primer
(F):5'- AGGACTGCTGGAGAATTATCTG -3'
(R):5'- TAGCTTGGAGCACATCTGAC -3'
Posted On 2014-03-28