Mutagenetix > Incidental Mutations

Incidental Mutation 'R1185:Cecr2'

165248

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

039257-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1185 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 120758205 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 24 (R24*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]

Predicted Effect

probably null
Transcript: ENSMUST00000100993
AA Change: R801*

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: R801*

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112686
AA Change: R773*

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: R773*

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124634

Predicted Effect

probably benign
Transcript: ENSMUST00000129803

SMART Domains

Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
coiled coil region	90	150	N/A	INTRINSIC
Pfam:Bromodomain	191	234	1.1e-9	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000143563
AA Change: R24*

SMART Domains

Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226
AA Change: R24*

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	63	79	N/A	INTRINSIC
low complexity region	114	131	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC

Meta Mutation Damage Score

0.9707

Coding Region Coverage

1x: 99.6%
3x: 98.3%
10x: 93.0%
20x: 79.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ac165356.1	C	T	7: 106,083,479	A190T	probably benign	Het
AC211878.1	A	G	12: 87,773,708	V27A	probably benign	Het
Aimp2	A	G	5: 143,904,691	S110P	possibly damaging	Het
Akap9	A	G	5: 3,948,783	T51A	probably benign	Het
Arhgef25	A	G	10: 127,183,781	F430L	possibly damaging	Het
Brap	T	C	5: 121,675,279	V235A	probably damaging	Het
CAAA01123846.1	C	A	4: 156,351,101	A258D	probably benign	Het
Cd69	C	T	6: 129,270,185	G23D	probably damaging	Het
Celsr2	T	C	3: 108,399,709	D1974G	possibly damaging	Het
Cps1	A	G	1: 67,195,199	K915R	probably benign	Het
Csmd1	T	C	8: 16,358,348	D401G	probably damaging	Het
Dusp13	A	G	14: 21,735,018	F141S	probably damaging	Het
Fam162b	A	G	10: 51,590,343	W27R	probably benign	Het
Focad	A	G	4: 88,178,187	T269A	probably benign	Het
Ghr	T	A	15: 3,328,062	R241S	possibly damaging	Het
Hirip3	AAGAG	AAG	7: 126,863,660		probably null	Het
Itgb2l	A	G	16: 96,429,040	Y357H	possibly damaging	Het
Jrkl	T	C	9: 13,244,933	D241G	possibly damaging	Het
Lmod1	A	G	1: 135,364,229	D274G	probably benign	Het
Lrrn2	A	G	1: 132,939,221	S675G	probably benign	Het
Ltbp4	G	C	7: 27,310,535	P1200R	probably damaging	Het
Mdn1	T	C	4: 32,735,576	L3414P	possibly damaging	Het
Muc19	A	G	15: 91,878,549		noncoding transcript	Het
Neb	A	G	2: 52,296,298	Y921H	probably damaging	Het
Olfr135	T	A	17: 38,209,183	*313R	probably null	Het
Pgap3	T	C	11: 98,391,134	D117G	probably damaging	Het
Ppp1r9b	T	C	11: 95,001,986	F671L	possibly damaging	Het
Purg	T	G	8: 33,386,869	Y178*	probably null	Het
Rsph10b	G	A	5: 143,966,462		probably benign	Het
Sorbs1	T	A	19: 40,382,606	D79V	probably damaging	Het
Tcaf3	T	C	6: 42,591,434	T663A	probably damaging	Het
Timd4	C	A	11: 46,817,648	T167K	probably damaging	Het
Tjp2	A	G	19: 24,131,163	L195P	possibly damaging	Het
Tnr	G	A	1: 159,852,286	A277T	probably benign	Het
Trpm3	G	A	19: 22,914,417		probably benign	Het
Unc13a	C	T	8: 71,661,833	G181D	probably benign	Het
Vmn1r11	T	A	6: 57,137,507	L52Q	possibly damaging	Het
Zfp27	T	C	7: 29,895,829	D237G	possibly damaging	Het
Zfp39	T	C	11: 58,902,844	T23A	possibly damaging	Het
Zfp459	T	G	13: 67,408,481	N161T	probably benign	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	intron	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATCCACCAGCTCCATTCCAGG -3'
(R):5'- CTGCTGCATGGCAATCATTTCAGG -3'

Sequencing Primer
(F):5'- TGAAAGCTCTGAAATTCCTCCCG -3'
(R):5'- GCAATCATTTCAGGGCTGTC -3'

Posted On

2014-03-28