Incidental Mutation 'R1572:Efr3a'
Institutional Source Beutler Lab
Gene Symbol Efr3a
Ensembl Gene ENSMUSG00000015002
Gene NameEFR3 homolog A
SynonymsA130089M23Rik, D030063F01Rik, C920006C10Rik
MMRRC Submission 039611-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R1572 (G1)
Quality Score225
Status Validated
Chromosomal Location65787034-65873816 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 65854792 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015146] [ENSMUST00000173858] [ENSMUST00000211878] [ENSMUST00000211878]
Predicted Effect probably null
Transcript: ENSMUST00000015146
SMART Domains Protein: ENSMUSP00000015146
Gene: ENSMUSG00000015002

SCOP:d1gw5a_ 226 584 5e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173858
SMART Domains Protein: ENSMUSP00000134385
Gene: ENSMUSG00000015002

SCOP:d1gw5a_ 226 584 8e-4 SMART
low complexity region 709 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174749
Predicted Effect probably null
Transcript: ENSMUST00000211878
Predicted Effect probably null
Transcript: ENSMUST00000211878
Predicted Effect probably benign
Transcript: ENSMUST00000227340
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 92.9%
  • 20x: 80.7%
Validation Efficiency 97% (130/134)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a complex that plays a role in maintaining an active pool of phosphatidylinositol 4-kinase (PI4K) at the plasma membrane. This protein is thought to be a peripheral membrane protein that associates with the plasma membrane through palmitoylation. Studies indicate that this gene product plays a role in controlling G protein-coupled receptor (GPCR) activity by affecting receptor phosphorylation. Whole exome sequencing studies have implicated mutations in this gene with autism spectrum disorders. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik G A 9: 50,740,673 T85M probably damaging Het
5430419D17Rik T A 7: 131,244,831 Y777* probably null Het
Actn1 A G 12: 80,172,957 probably benign Het
Afap1l1 A T 18: 61,737,499 S603T probably damaging Het
Ahcy T C 2: 155,068,931 Y39C probably benign Het
Ankmy2 T C 12: 36,186,942 probably null Het
Anxa13 A T 15: 58,348,807 noncoding transcript Het
Aoc1 T C 6: 48,905,786 S221P possibly damaging Het
Arhgef10 C A 8: 14,991,211 A770D possibly damaging Het
Arhgef19 A G 4: 141,254,754 D707G probably benign Het
Arhgef3 G A 14: 27,401,735 R444H probably damaging Het
Asphd1 T C 7: 126,949,099 I11V probably benign Het
Atp2b1 A G 10: 98,994,675 M333V probably benign Het
BC051665 T C 13: 60,785,027 Y40C probably damaging Het
Ccdc87 T A 19: 4,840,313 S278T probably benign Het
Chaf1b G A 16: 93,901,230 G463D possibly damaging Het
Chrna4 T C 2: 181,029,307 T219A possibly damaging Het
Clcnkb T G 4: 141,407,095 T584P possibly damaging Het
Clptm1l T C 13: 73,607,747 S161P probably benign Het
Cmya5 T C 13: 93,094,269 E1437G possibly damaging Het
Col13a1 A T 10: 61,866,426 probably null Het
Col3a1 T C 1: 45,345,968 S82P possibly damaging Het
Cpeb3 A T 19: 37,139,082 M383K probably benign Het
Cr2 T A 1: 195,163,314 H111L probably damaging Het
Cttnbp2 T C 6: 18,375,975 S1522G possibly damaging Het
Cul3 T C 1: 80,282,789 D281G possibly damaging Het
Cyp2c70 T G 19: 40,183,982 K72T probably benign Het
Cyp39a1 A T 17: 43,680,129 I110F probably damaging Het
Cyp46a1 T A 12: 108,351,939 M203K probably null Het
Cyp8b1 A T 9: 121,914,958 V436D possibly damaging Het
Ddx17 T C 15: 79,538,565 D324G probably damaging Het
Dopey2 A G 16: 93,770,153 N1274S probably damaging Het
Dscaml1 G A 9: 45,721,333 V1166I probably benign Het
Dsp T C 13: 38,195,738 V1554A probably damaging Het
Dusp27 C T 1: 166,099,455 V863M possibly damaging Het
Egfem1 A T 3: 29,648,271 N223I probably benign Het
Egr2 T C 10: 67,539,975 S147P probably damaging Het
Elmo3 A G 8: 105,308,301 T408A probably benign Het
Flnb A G 14: 7,883,908 D378G probably damaging Het
Foxj2 T A 6: 122,833,261 M193K probably benign Het
Gm6327 A G 16: 12,760,156 noncoding transcript Het
Gm7694 T C 1: 170,302,766 H21R probably benign Het
Gpr107 A G 2: 31,167,025 D43G probably damaging Het
Grid2 T A 6: 64,429,694 Y679* probably null Het
Grin2c G A 11: 115,256,074 P432S possibly damaging Het
H2-M10.1 A G 17: 36,325,733 F60L possibly damaging Het
Hectd4 A G 5: 121,301,878 D1147G possibly damaging Het
Idua G T 5: 108,680,589 A223S probably benign Het
Ifi206 T C 1: 173,486,853 Q7R probably benign Het
Itgad T A 7: 128,203,234 V986E probably damaging Het
Itsn2 G A 12: 4,650,044 R670H probably benign Het
Kdm4a T C 4: 118,138,949 E961G possibly damaging Het
Klra5 T A 6: 129,906,622 I91L probably damaging Het
Kntc1 A G 5: 123,772,113 T525A probably damaging Het
Lct A G 1: 128,294,195 F1536L probably benign Het
Lmod1 T A 1: 135,363,933 D175E probably benign Het
Lonrf1 A C 8: 36,233,972 D361E probably benign Het
Lrrc19 T C 4: 94,638,429 Y297C probably damaging Het
Mast4 T C 13: 102,736,923 E1787G possibly damaging Het
Mpp2 G A 11: 102,060,548 A452V probably benign Het
Msh2 T C 17: 87,718,652 V686A possibly damaging Het
Mthfd1 C T 12: 76,270,419 Q15* probably null Het
Mtnr1b A T 9: 15,863,142 I207N probably damaging Het
Nid2 A G 14: 19,805,412 T1207A probably benign Het
Nin A T 12: 70,038,750 V1569D probably damaging Het
Nov T A 15: 54,749,252 M219K possibly damaging Het
Nrcam T A 12: 44,537,364 probably benign Het
Nsd1 T A 13: 55,246,969 H897Q probably damaging Het
Olfr102 A T 17: 37,313,480 N301K probably benign Het
Olfr1364 T A 13: 21,574,310 I49F possibly damaging Het
Olfr77 G T 9: 19,920,912 K234N probably benign Het
Olfr979 A G 9: 40,001,194 F11S probably benign Het
Paip1 T C 13: 119,451,784 probably benign Het
Pcnx3 G A 19: 5,685,347 R484* probably null Het
Pdxk A G 10: 78,447,980 Y127H probably damaging Het
Phf20 T A 2: 156,287,834 V442E probably benign Het
Phlpp1 G A 1: 106,392,789 D1505N probably damaging Het
Pkhd1 T C 1: 20,347,440 T2496A probably benign Het
Pkhd1l1 A G 15: 44,543,473 T2369A probably benign Het
Plod2 T A 9: 92,603,067 probably benign Het
Pnpla7 T A 2: 25,015,251 M617K possibly damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prkch T A 12: 73,649,357 probably null Het
Prr12 G A 7: 45,028,800 H1974Y unknown Het
Prr16 A G 18: 51,302,970 I174V probably benign Het
Prss45 A T 9: 110,838,429 T39S probably benign Het
Pum1 T A 4: 130,718,204 D161E probably damaging Het
Rad51ap2 A G 12: 11,457,112 D345G probably damaging Het
Ralgapb A G 2: 158,446,199 probably benign Het
Rasgrp3 A G 17: 75,500,734 H262R possibly damaging Het
Rnf213 T A 11: 119,436,611 I1809N probably damaging Het
Ryr1 A G 7: 29,062,191 L3177P probably damaging Het
Scyl2 C A 10: 89,650,956 R230L probably damaging Het
Sfxn2 T C 19: 46,582,476 probably benign Het
Slc18b1 T C 10: 23,798,741 probably benign Het
Spata31d1d T C 13: 59,728,191 H510R probably benign Het
Stab1 A T 14: 31,150,823 N1109K probably damaging Het
Sult3a2 A G 10: 33,781,977 S47P probably damaging Het
Tenm3 T C 8: 48,228,993 N2518S possibly damaging Het
Tex21 G T 12: 76,206,891 P416Q probably benign Het
Tex38 T C 4: 115,780,306 N100S probably benign Het
Thsd4 A C 9: 60,394,553 probably benign Het
Ticrr T C 7: 79,681,824 V723A probably damaging Het
Tmprss15 A G 16: 79,090,829 V30A probably benign Het
Uba3 A G 6: 97,185,337 probably benign Het
Ubr1 T C 2: 120,935,319 probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Vmn2r112 A T 17: 22,603,144 T268S possibly damaging Het
Wfdc3 T C 2: 164,744,194 probably benign Het
Zfp282 T A 6: 47,892,867 L282Q probably damaging Het
Zfp422 A T 6: 116,626,784 C85S probably damaging Het
Zfp790 A T 7: 29,828,139 Q83L probably benign Het
Other mutations in Efr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Efr3a APN 15 65855417 missense possibly damaging 0.66
IGL01070:Efr3a APN 15 65853078 missense probably benign
IGL01366:Efr3a APN 15 65851150 missense probably benign 0.37
IGL01754:Efr3a APN 15 65854720 missense probably damaging 0.96
IGL02121:Efr3a APN 15 65871150 splice site probably benign
BB007:Efr3a UTSW 15 65861740 missense probably benign
BB017:Efr3a UTSW 15 65861740 missense probably benign
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0096:Efr3a UTSW 15 65855441 missense probably damaging 1.00
R0139:Efr3a UTSW 15 65845981 missense possibly damaging 0.58
R0449:Efr3a UTSW 15 65842704 missense probably damaging 1.00
R0786:Efr3a UTSW 15 65853551 missense possibly damaging 0.47
R0827:Efr3a UTSW 15 65853551 missense possibly damaging 0.70
R0843:Efr3a UTSW 15 65837423 splice site probably benign
R1433:Efr3a UTSW 15 65869057 intron probably benign
R2290:Efr3a UTSW 15 65849839 missense probably benign 0.00
R2764:Efr3a UTSW 15 65849770 missense possibly damaging 0.94
R4170:Efr3a UTSW 15 65845982 missense probably damaging 0.98
R4368:Efr3a UTSW 15 65866780 missense possibly damaging 0.82
R4683:Efr3a UTSW 15 65819801 missense probably damaging 1.00
R4797:Efr3a UTSW 15 65857588 missense probably damaging 1.00
R5495:Efr3a UTSW 15 65815409 missense possibly damaging 0.73
R6262:Efr3a UTSW 15 65857474 missense possibly damaging 0.90
R6552:Efr3a UTSW 15 65857490 missense possibly damaging 0.52
R6825:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6833:Efr3a UTSW 15 65842686 missense probably damaging 1.00
R6852:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6853:Efr3a UTSW 15 65829830 missense probably benign 0.18
R6996:Efr3a UTSW 15 65848181 nonsense probably null
R7327:Efr3a UTSW 15 65819778 missense probably damaging 0.98
R7467:Efr3a UTSW 15 65857511 missense possibly damaging 0.65
R7549:Efr3a UTSW 15 65815413 critical splice donor site probably null
R7671:Efr3a UTSW 15 65837434 critical splice acceptor site probably null
R7810:Efr3a UTSW 15 65787173 start gained probably benign
R7830:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7832:Efr3a UTSW 15 65829830 missense probably benign 0.18
R7900:Efr3a UTSW 15 65848135 splice site probably null
R7904:Efr3a UTSW 15 65824678 missense probably damaging 1.00
R7930:Efr3a UTSW 15 65861740 missense probably benign
R8115:Efr3a UTSW 15 65866795 missense probably damaging 1.00
R8244:Efr3a UTSW 15 65815368 missense probably damaging 1.00
R8388:Efr3a UTSW 15 65866822 missense probably benign 0.42
R8859:Efr3a UTSW 15 65854765 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggagagatggttcaatggttaag -3'
Posted On2014-04-13