Mutagenetix > Incidental Mutation

Incidental Mutation 'R1572:Pkhd1'

170805

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

039611-MU

Accession Numbers

Genbank: NM_153179; MGI: 2155808

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R1572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20057779-20618064 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20347440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2496 (T2496A)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000088448
AA Change: T2496A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: T2496A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Meta Mutation Damage Score

0.0843

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 92.9%
20x: 80.7%

Validation Efficiency

97% (130/134)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310030G06Rik	G	A	9: 50,740,673	T85M	probably damaging	Het
5430419D17Rik	T	A	7: 131,244,831	Y777*	probably null	Het
Actn1	A	G	12: 80,172,957		probably benign	Het
Afap1l1	A	T	18: 61,737,499	S603T	probably damaging	Het
Ahcy	T	C	2: 155,068,931	Y39C	probably benign	Het
Ankmy2	T	C	12: 36,186,942		probably null	Het
Anxa13	A	T	15: 58,348,807		noncoding transcript	Het
Aoc1	T	C	6: 48,905,786	S221P	possibly damaging	Het
Arhgef10	C	A	8: 14,991,211	A770D	possibly damaging	Het
Arhgef19	A	G	4: 141,254,754	D707G	probably benign	Het
Arhgef3	G	A	14: 27,401,735	R444H	probably damaging	Het
Asphd1	T	C	7: 126,949,099	I11V	probably benign	Het
Atp2b1	A	G	10: 98,994,675	M333V	probably benign	Het
BC051665	T	C	13: 60,785,027	Y40C	probably damaging	Het
Ccdc87	T	A	19: 4,840,313	S278T	probably benign	Het
Chaf1b	G	A	16: 93,901,230	G463D	possibly damaging	Het
Chrna4	T	C	2: 181,029,307	T219A	possibly damaging	Het
Clcnkb	T	G	4: 141,407,095	T584P	possibly damaging	Het
Clptm1l	T	C	13: 73,607,747	S161P	probably benign	Het
Cmya5	T	C	13: 93,094,269	E1437G	possibly damaging	Het
Col13a1	A	T	10: 61,866,426		probably null	Het
Col3a1	T	C	1: 45,345,968	S82P	possibly damaging	Het
Cpeb3	A	T	19: 37,139,082	M383K	probably benign	Het
Cr2	T	A	1: 195,163,314	H111L	probably damaging	Het
Cttnbp2	T	C	6: 18,375,975	S1522G	possibly damaging	Het
Cul3	T	C	1: 80,282,789	D281G	possibly damaging	Het
Cyp2c70	T	G	19: 40,183,982	K72T	probably benign	Het
Cyp39a1	A	T	17: 43,680,129	I110F	probably damaging	Het
Cyp46a1	T	A	12: 108,351,939	M203K	probably null	Het
Cyp8b1	A	T	9: 121,914,958	V436D	possibly damaging	Het
Ddx17	T	C	15: 79,538,565	D324G	probably damaging	Het
Dopey2	A	G	16: 93,770,153	N1274S	probably damaging	Het
Dscaml1	G	A	9: 45,721,333	V1166I	probably benign	Het
Dsp	T	C	13: 38,195,738	V1554A	probably damaging	Het
Dusp27	C	T	1: 166,099,455	V863M	possibly damaging	Het
Efr3a	T	A	15: 65,854,792		probably null	Het
Egfem1	A	T	3: 29,648,271	N223I	probably benign	Het
Egr2	T	C	10: 67,539,975	S147P	probably damaging	Het
Elmo3	A	G	8: 105,308,301	T408A	probably benign	Het
Flnb	A	G	14: 7,883,908	D378G	probably damaging	Het
Foxj2	T	A	6: 122,833,261	M193K	probably benign	Het
Gm6327	A	G	16: 12,760,156		noncoding transcript	Het
Gm7694	T	C	1: 170,302,766	H21R	probably benign	Het
Gpr107	A	G	2: 31,167,025	D43G	probably damaging	Het
Grid2	T	A	6: 64,429,694	Y679*	probably null	Het
Grin2c	G	A	11: 115,256,074	P432S	possibly damaging	Het
H2-M10.1	A	G	17: 36,325,733	F60L	possibly damaging	Het
Hectd4	A	G	5: 121,301,878	D1147G	possibly damaging	Het
Idua	G	T	5: 108,680,589	A223S	probably benign	Het
Ifi206	T	C	1: 173,486,853	Q7R	probably benign	Het
Itgad	T	A	7: 128,203,234	V986E	probably damaging	Het
Itsn2	G	A	12: 4,650,044	R670H	probably benign	Het
Kdm4a	T	C	4: 118,138,949	E961G	possibly damaging	Het
Klra5	T	A	6: 129,906,622	I91L	probably damaging	Het
Kntc1	A	G	5: 123,772,113	T525A	probably damaging	Het
Lct	A	G	1: 128,294,195	F1536L	probably benign	Het
Lmod1	T	A	1: 135,363,933	D175E	probably benign	Het
Lonrf1	A	C	8: 36,233,972	D361E	probably benign	Het
Lrrc19	T	C	4: 94,638,429	Y297C	probably damaging	Het
Mast4	T	C	13: 102,736,923	E1787G	possibly damaging	Het
Mpp2	G	A	11: 102,060,548	A452V	probably benign	Het
Msh2	T	C	17: 87,718,652	V686A	possibly damaging	Het
Mthfd1	C	T	12: 76,270,419	Q15*	probably null	Het
Mtnr1b	A	T	9: 15,863,142	I207N	probably damaging	Het
Nid2	A	G	14: 19,805,412	T1207A	probably benign	Het
Nin	A	T	12: 70,038,750	V1569D	probably damaging	Het
Nov	T	A	15: 54,749,252	M219K	possibly damaging	Het
Nrcam	T	A	12: 44,537,364		probably benign	Het
Nsd1	T	A	13: 55,246,969	H897Q	probably damaging	Het
Olfr102	A	T	17: 37,313,480	N301K	probably benign	Het
Olfr1364	T	A	13: 21,574,310	I49F	possibly damaging	Het
Olfr77	G	T	9: 19,920,912	K234N	probably benign	Het
Olfr979	A	G	9: 40,001,194	F11S	probably benign	Het
Paip1	T	C	13: 119,451,784		probably benign	Het
Pcnx3	G	A	19: 5,685,347	R484*	probably null	Het
Pdxk	A	G	10: 78,447,980	Y127H	probably damaging	Het
Phf20	T	A	2: 156,287,834	V442E	probably benign	Het
Phlpp1	G	A	1: 106,392,789	D1505N	probably damaging	Het
Pkhd1l1	A	G	15: 44,543,473	T2369A	probably benign	Het
Plod2	T	A	9: 92,603,067		probably benign	Het
Pnpla7	T	A	2: 25,015,251	M617K	possibly damaging	Het
Ppp1r16a	C	T	15: 76,693,669	Q328*	probably null	Het
Prkch	T	A	12: 73,649,357		probably null	Het
Prr12	G	A	7: 45,028,800	H1974Y	unknown	Het
Prr16	A	G	18: 51,302,970	I174V	probably benign	Het
Prss45	A	T	9: 110,838,429	T39S	probably benign	Het
Pum1	T	A	4: 130,718,204	D161E	probably damaging	Het
Rad51ap2	A	G	12: 11,457,112	D345G	probably damaging	Het
Ralgapb	A	G	2: 158,446,199		probably benign	Het
Rasgrp3	A	G	17: 75,500,734	H262R	possibly damaging	Het
Rnf213	T	A	11: 119,436,611	I1809N	probably damaging	Het
Ryr1	A	G	7: 29,062,191	L3177P	probably damaging	Het
Scyl2	C	A	10: 89,650,956	R230L	probably damaging	Het
Sfxn2	T	C	19: 46,582,476		probably benign	Het
Slc18b1	T	C	10: 23,798,741		probably benign	Het
Spata31d1d	T	C	13: 59,728,191	H510R	probably benign	Het
Stab1	A	T	14: 31,150,823	N1109K	probably damaging	Het
Sult3a2	A	G	10: 33,781,977	S47P	probably damaging	Het
Tenm3	T	C	8: 48,228,993	N2518S	possibly damaging	Het
Tex21	G	T	12: 76,206,891	P416Q	probably benign	Het
Tex38	T	C	4: 115,780,306	N100S	probably benign	Het
Thsd4	A	C	9: 60,394,553		probably benign	Het
Ticrr	T	C	7: 79,681,824	V723A	probably damaging	Het
Tmprss15	A	G	16: 79,090,829	V30A	probably benign	Het
Uba3	A	G	6: 97,185,337		probably benign	Het
Ubr1	T	C	2: 120,935,319		probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Vmn2r112	A	T	17: 22,603,144	T268S	possibly damaging	Het
Wfdc3	T	C	2: 164,744,194		probably benign	Het
Zfp282	T	A	6: 47,892,867	L282Q	probably damaging	Het
Zfp422	A	T	6: 116,626,784	C85S	probably damaging	Het
Zfp790	A	T	7: 29,828,139	Q83L	probably benign	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20566874	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20524070	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20081184	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20571390	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20117747	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20523258	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20209176	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20534530	splice site	probably benign
IGL01313:Pkhd1	APN	1	20201024	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20522977	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20549715	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20199459	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20559419	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20116979	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20534633	nonsense	probably null
IGL01790:Pkhd1	APN	1	20558671	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20358910	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20103235	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20220083	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20198137	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20523567	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20522747	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20201227	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20377399	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20117195	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20275615	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20584101	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20209260	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20070376	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20200783	missense	probably benign
IGL02389:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20199486	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20562418	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20414421	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20522759	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20364201	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20392165	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20073507	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20117720	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20310710	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20520256	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20550902	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20558752	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20220029	splice site	probably benign
IGL02752:Pkhd1	APN	1	20553591	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20361011	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20608416	nonsense	probably null
IGL02960:Pkhd1	APN	1	20377446	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20522963	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20522699	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20565633	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20198171	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20201019	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20081300	splice site	probably benign
IGL03375:Pkhd1	APN	1	20117023	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20200670	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20522894	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20537365	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20611414	intron	probably benign
P0035:Pkhd1	UTSW	1	20117347	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20222906	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20211950	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20201344	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20209246	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20523359	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0105:Pkhd1	UTSW	1	20523732	nonsense	probably null
R0115:Pkhd1	UTSW	1	20350490	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20358917	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20540400	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20549822	splice site	probably null
R0323:Pkhd1	UTSW	1	20275538	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20381547	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20117788	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20559469	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20310514	splice site	probably benign
R0550:Pkhd1	UTSW	1	20347223	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20239436	nonsense	probably null
R0586:Pkhd1	UTSW	1	20524111	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20200890	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20117173	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20117474	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20524230	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20198107	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20117484	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20350521	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20199381	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20201259	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20117726	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20522829	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20567456	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20571405	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20555223	splice site	probably benign
R1411:Pkhd1	UTSW	1	20373896	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20534558	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20585157	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20523341	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20522983	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20117401	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1583:Pkhd1	UTSW	1	20117825	missense	probably benign
R1617:Pkhd1	UTSW	1	20198050	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20522897	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20584129	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20550840	splice site	probably benign
R1753:Pkhd1	UTSW	1	20533905	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20565711	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20585152	splice site	probably benign
R1822:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20347457	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20117069	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20551020	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20615267	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20566756	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20081300	splice site	probably benign
R1969:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20117060	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20199459	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20200669	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20612812	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20201335	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20553574	nonsense	probably null
R2142:Pkhd1	UTSW	1	20523895	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20414220	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20553517	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20537360	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20565639	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20534535	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20200849	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20200855	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20201165	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20209182	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20058302	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20222961	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20104599	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20555129	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20585655	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20058300	makesense	probably null
R3838:Pkhd1	UTSW	1	20534629	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20558723	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20200927	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20312138	nonsense	probably null
R3926:Pkhd1	UTSW	1	20550873	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20209277	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20563686	missense	probably benign	0.06
R4255:Pkhd1	UTSW	1	20593934	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20058384	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20058617	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20414292	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20239411	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20523314	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20211858	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20534719	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20613409	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20200868	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20503056	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20381523	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20364167	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20081228	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20524130	missense	probably benign
R4750:Pkhd1	UTSW	1	20524112	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20199415	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20537401	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20070488	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20209226	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20288205	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20585711	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20585191	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20209224	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20547341	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20275641	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20534545	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20350411	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20509076	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20565870	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20450304	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20392097	missense	probably benign
R5346:Pkhd1	UTSW	1	20523434	missense	probably damaging	0.96
R5431:Pkhd1	UTSW	1	20117836	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20239385	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20201156	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20377404	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20081252	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20523142	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20073526	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20558626	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20117807	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20588531	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20547461	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20523651	nonsense	probably null
R5760:Pkhd1	UTSW	1	20073554	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20209185	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20058600	missense	probably benign
R5810:Pkhd1	UTSW	1	20200673	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20199405	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20058678	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20201083	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20381461	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20374736	nonsense	probably null
R5852:Pkhd1	UTSW	1	20377408	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20520210	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20523770	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20211951	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20551020	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20585703	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20200823	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20612705	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20058339	missense	probably benign
R6886:Pkhd1	UTSW	1	20347280	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20523515	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20534701	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20562451	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20558719	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20523126	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20547519	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20593953	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20200973	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20239304	missense	not run
R7436:Pkhd1	UTSW	1	20200701	missense	probably benign
R7473:Pkhd1	UTSW	1	20549756	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20347361	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20200925	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20547493	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20562415	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20502999	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20312049	missense	probably benign
R7920:Pkhd1	UTSW	1	20275535	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20508891	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20381438	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20613415	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20523089	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20200757	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20562458	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20537420	splice site	probably benign
R8485:Pkhd1	UTSW	1	20523033	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20520208	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20522975	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20392150	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20288237	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20073455	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20117561	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20392010	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20347305	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20364201	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20522751	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20502952	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20562362	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20534575	missense	possibly damaging	0.89
R9258:Pkhd1	UTSW	1	20373950	missense	probably damaging	0.99
R9262:Pkhd1	UTSW	1	20548127	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20222894	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20612729	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20567517	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20199346	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20117780	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20392213	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20547466	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20350484	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20414412	missense	probably benign
R9781:Pkhd1	UTSW	1	20117441	missense	possibly damaging	0.95
R9803:Pkhd1	UTSW	1	20566849	missense	probably damaging	1.00
X0012:Pkhd1	UTSW	1	20373926	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20520226	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20523747	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20117883	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20310594	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523621	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20523938	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20551019	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATGGAAGAGAACAGCTTCGCCAC -3'
(R):5'- TCTACCACAGAGCCCTGACGTAAG -3'

Sequencing Primer
(F):5'- TGCCAGGGACAATCTGACTG -3'
(R):5'- GCCCTGACGTAAGGGAATAC -3'

Posted On

2014-04-13