Incidental Mutation 'R1649:Olfm1'
ID174074
Institutional Source Beutler Lab
Gene Symbol Olfm1
Ensembl Gene ENSMUSG00000026833
Gene Nameolfactomedin 1
SynonymsNoelin 1, Pancortin 1-4, Noelin 2
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28192992-28230736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28229267 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 333 (T333S)
Ref Sequence ENSEMBL: ENSMUSP00000028177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028177] [ENSMUST00000100244] [ENSMUST00000113920]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028177
AA Change: T333S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028177
Gene: ENSMUSG00000026833
AA Change: T333S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 54 153 1.5e-50 PFAM
Blast:OLF 170 215 1e-5 BLAST
OLF 228 478 5.43e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100244
AA Change: T305S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097815
Gene: ENSMUSG00000026833
AA Change: T305S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Noelin-1 25 125 2.6e-53 PFAM
Blast:OLF 142 187 1e-5 BLAST
OLF 200 450 5.43e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113920
AA Change: T290S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109553
Gene: ENSMUSG00000026833
AA Change: T290S

DomainStartEndE-ValueType
Pfam:Noelin-1 10 110 7.4e-53 PFAM
Blast:OLF 127 172 1e-5 BLAST
OLF 185 435 5.43e-170 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product shares extensive sequence similarity with the rat neuronal olfactomedin-related ER localized protein. While the exact function of the encoded protein is not known, its abundant expression in brain suggests that it may have an essential role in nerve tissue. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display decreased cerebral infarction size and reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Olfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Olfm1 APN 2 28214703 missense probably damaging 1.00
IGL01326:Olfm1 APN 2 28229552 missense probably damaging 1.00
IGL01358:Olfm1 APN 2 28229495 missense probably damaging 1.00
IGL02076:Olfm1 APN 2 28222625 missense probably damaging 0.99
IGL02337:Olfm1 APN 2 28229685 missense probably damaging 1.00
IGL02693:Olfm1 APN 2 28212650 missense probably damaging 1.00
IGL02825:Olfm1 APN 2 28229078 missense probably damaging 1.00
IGL02974:Olfm1 APN 2 28229689 missense probably damaging 1.00
R0266:Olfm1 UTSW 2 28229607 missense probably damaging 1.00
R0348:Olfm1 UTSW 2 28212542 missense probably benign 0.26
R0411:Olfm1 UTSW 2 28208211 missense possibly damaging 0.51
R0542:Olfm1 UTSW 2 28214628 missense possibly damaging 0.85
R1252:Olfm1 UTSW 2 28229435 missense probably benign 0.01
R1696:Olfm1 UTSW 2 28208116 nonsense probably null
R1931:Olfm1 UTSW 2 28222662 splice site probably null
R1986:Olfm1 UTSW 2 28214706 missense probably benign 0.13
R3749:Olfm1 UTSW 2 28208088 missense probably damaging 0.96
R3913:Olfm1 UTSW 2 28208174 missense possibly damaging 0.88
R4927:Olfm1 UTSW 2 28214786 missense probably benign 0.18
R4940:Olfm1 UTSW 2 28222590 missense possibly damaging 0.51
R7033:Olfm1 UTSW 2 28229336 missense probably damaging 1.00
R7059:Olfm1 UTSW 2 28222616 missense probably damaging 1.00
R8046:Olfm1 UTSW 2 28229123 missense possibly damaging 0.71
X0018:Olfm1 UTSW 2 28229369 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GGTTATCACAACAACCGCTTCGTCC -3'
(R):5'- CCGAGTAACCGTTGGTGACATAGAG -3'

Sequencing Primer
(F):5'- TCGTCCGTGAGTACAAGTCC -3'
(R):5'- TGACATAGAGGGTGCCGC -3'
Posted On2014-04-24