Incidental Mutation 'R1649:Kitl'
ID174112
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Namekit ligand
SynonymsGb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location100015630-100100416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100064114 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000123360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190] [ENSMUST00000218200]
Predicted Effect probably benign
Transcript: ENSMUST00000020129
AA Change: T54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: T54A

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105283
AA Change: T54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: T54A

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130190
AA Change: T94A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966
AA Change: T94A

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218200
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
Gregory UTSW 10 100076906 critical splice donor site probably null
mooyah UTSW 10 100088222 critical splice donor site probably null
Sandycheeks UTSW 10 100076906 critical splice donor site probably null
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5135:Kitl UTSW 10 100088222 critical splice donor site probably null
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5832:Kitl UTSW 10 100080020 missense probably damaging 1.00
R5971:Kitl UTSW 10 100076906 critical splice donor site probably null
R6043:Kitl UTSW 10 100064085 missense probably damaging 1.00
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
R7315:Kitl UTSW 10 100016112 missense unknown
R7368:Kitl UTSW 10 100016081 missense probably benign 0.02
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGGATTGACAACCCAAGCACTG -3'
(R):5'- ACATTCAAGCCCCTTTGAGAGTTGC -3'

Sequencing Primer
(F):5'- TGACAACCCAAGCACTGTATATTG -3'
(R):5'- CCCCTTTGAGAGTTGCAGAGAG -3'
Posted On2014-04-24