Incidental Mutation 'R1598:Ttll5'
ID175970
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission 039635-MU
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85863598 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 207 (V207A)
Ref Sequence ENSEMBL: ENSMUSP00000134971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110220] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably damaging
Transcript: ENSMUST00000040179
AA Change: V207A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000040273
AA Change: V207A

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095536
AA Change: V207A

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.2e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110220
AA Change: V207A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105849
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 348 3.5e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110224
AA Change: V207A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155448
AA Change: V207A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176008
Predicted Effect probably damaging
Transcript: ENSMUST00000176695
AA Change: V207A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177114
AA Change: V207A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: V207A

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 intron probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACCCACAGTGGTATGCTCTCTGG -3'
(R):5'- ACTGCACACAGCTTTAGTCATGCTC -3'

Sequencing Primer
(F):5'- GGTAAAGAACTTTCCCCACCCA -3'
(R):5'- CAAACAGTGCAGTCTTCAGATG -3'
Posted On2014-04-24