Mutagenetix > Incidental Mutation

Incidental Mutation 'R4049:Ttll5'

314058

Institutional Source

Beutler Lab

Gene Symbol

Ttll5

Ensembl Gene

ENSMUSG00000012609

Gene Name

tubulin tyrosine ligase-like family, member 5

Synonyms

STAMP

MMRRC Submission

041616-MU

Accession Numbers

Genbank: NM_001081423

Is this an essential gene?

Possibly non essential (E-score: 0.479) question?

Stock #

R4049 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85824659-86061893 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86012799 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1226 (V1226A)

Ref Sequence

ENSEMBL: ENSMUSP00000105853 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]

AlphaFold

Q8CHB8

Predicted Effect

probably benign
Transcript: ENSMUST00000040179
AA Change: V1240A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: V1240A

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1.9e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000040273
AA Change: V1240A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: V1240A

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110224
AA Change: V1226A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: V1226A

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	543	562	N/A	INTRINSIC
low complexity region	582	608	N/A	INTRINSIC
low complexity region	734	748	N/A	INTRINSIC
low complexity region	768	780	N/A	INTRINSIC
low complexity region	822	834	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155448

SMART Domains

Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	6.4e-95	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000175844
AA Change: V208A

SMART Domains

Protein: ENSMUSP00000134934
Gene: ENSMUSG00000012609
AA Change: V208A

Domain	Start	End	E-Value	Type
low complexity region	136	150	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176695

SMART Domains

Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000176937
AA Change: V407A

Predicted Effect

probably benign
Transcript: ENSMUST00000177114

SMART Domains

Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000177168
AA Change: V675A

SMART Domains

Protein: ENSMUSP00000134874
Gene: ENSMUSG00000012609
AA Change: V675A

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
low complexity region	31	57	N/A	INTRINSIC
low complexity region	183	197	N/A	INTRINSIC
low complexity region	217	229	N/A	INTRINSIC
low complexity region	271	283	N/A	INTRINSIC
low complexity region	603	617	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000177525
AA Change: V369A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220906

Meta Mutation Damage Score

0.0635

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,868,669	E1190V	probably damaging	Het
Arhgef10	A	G	8: 14,979,998	T928A	probably benign	Het
Arhgef10l	T	A	4: 140,515,451	I836F	probably benign	Het
Blm	T	A	7: 80,502,862	T446S	probably benign	Het
Ccdc63	T	A	5: 122,122,750	Q237L	probably damaging	Het
Cep57l1	G	T	10: 41,729,360	R130S	probably damaging	Het
Clstn2	T	G	9: 97,457,560	E786A	possibly damaging	Het
Col16a1	C	T	4: 130,068,752	P540L	probably damaging	Het
Csf2	A	G	11: 54,249,333	F61L	probably damaging	Het
Ctr9	C	T	7: 111,055,543	R1094C	unknown	Het
Cyp3a41a	A	G	5: 145,713,540	C98R	probably damaging	Het
Dthd1	T	A	5: 62,827,165	C404*	probably null	Het
Egfem1	A	C	3: 29,686,731	H518P	probably benign	Het
Elf3	T	C	1: 135,254,277	S369G	probably benign	Het
Eml6	C	T	11: 29,838,577	V503M	probably damaging	Het
Enthd1	T	C	15: 80,560,039	D105G	probably damaging	Het
Eral1	A	G	11: 78,075,602	L250P	probably damaging	Het
Gdf15	A	T	8: 70,629,955	M167K	probably benign	Het
Ggps1	T	C	13: 14,053,699	K300E	probably benign	Het
Gm8074	G	A	9: 78,322,336		noncoding transcript	Het
Herc3	A	G	6: 58,876,837	I623V	probably damaging	Het
Mad1l1	A	G	5: 140,132,816	S457P	probably damaging	Het
Map1lc3a	G	T	2: 155,277,542	V91F	possibly damaging	Het
Map4k3	A	G	17: 80,605,965	V617A	probably benign	Het
Mov10l1	T	A	15: 88,995,032		probably benign	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Ncor1	G	T	11: 62,329,668		probably null	Het
Nfe2	C	T	15: 103,250,937	E36K	possibly damaging	Het
Olfr1176	T	C	2: 88,343,800		probably null	Het
Olfr1212	A	G	2: 88,959,273	K269R	probably benign	Het
Olfr1251	T	C	2: 89,667,662	I75V	probably benign	Het
Olfr653	T	C	7: 104,580,368	F241L	probably benign	Het
Oprm1	G	A	10: 6,829,087	V95I	probably benign	Het
Pcdha9	T	A	18: 36,997,942	H21Q	probably benign	Het
Pcolce2	A	T	9: 95,638,755	I62F	probably damaging	Het
Pfpl	T	A	19: 12,429,689	C435S	probably damaging	Het
Pkhd1l1	G	A	15: 44,498,557	C542Y	probably damaging	Het
Plekha5	T	C	6: 140,583,871	S75P	probably damaging	Het
Pphln1	C	A	15: 93,465,106	A202E	probably damaging	Het
Ppp1r1a	A	G	15: 103,532,454	L92P	probably damaging	Het
Prokr2	T	C	2: 132,381,494	T43A	probably benign	Het
Rai14	T	C	15: 10,592,212	N199S	probably benign	Het
Rasgrp2	T	C	19: 6,404,727	L199P	probably damaging	Het
Rnf213	A	C	11: 119,482,448	M4939L	possibly damaging	Het
Slc23a2	C	T	2: 132,060,683	R533Q	probably benign	Het
Slc7a7	T	C	14: 54,373,091		probably null	Het
Snrpd2	T	A	7: 19,151,307	V31E	probably damaging	Het
Spire1	G	T	18: 67,529,031		probably null	Het
Srsf4	T	C	4: 131,900,543		probably benign	Het
Tcf20	A	G	15: 82,853,429	S1274P	probably damaging	Het
Tcof1	C	A	18: 60,832,903	A376S	possibly damaging	Het
Thsd1	T	A	8: 22,243,164	Y76N	possibly damaging	Het
Timm44	A	G	8: 4,260,561	V397A	probably benign	Het
Tmc6	G	A	11: 117,778,261	T89I	possibly damaging	Het
Trbv31	C	A	6: 41,557,705	C107F	probably damaging	Het
Trim37	T	A	11: 87,140,603		probably null	Het
Ube3b	T	C	5: 114,412,870	V865A	probably benign	Het
Vmn2r86	A	T	10: 130,447,097	M550K	probably damaging	Het
Vps54	C	A	11: 21,300,183	T373N	probably benign	Het
Wdr64	T	G	1: 175,805,856	I891S	probably benign	Het
Wisp2	A	G	2: 163,828,984	D137G	probably damaging	Het
Zfhx4	C	T	3: 5,398,859	S1384L	probably damaging	Het
Zfp703	A	G	8: 26,979,085	E259G	possibly damaging	Het
Zfp933	T	C	4: 147,826,512	H209R	probably damaging	Het
Zfp980	A	G	4: 145,702,600	H633R	probably damaging	Het

Other mutations in Ttll5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Ttll5	APN	12	85843826	missense	probably damaging	1.00
IGL00932:Ttll5	APN	12	85929907	missense	probably damaging	1.00
IGL00964:Ttll5	APN	12	85849283	missense	possibly damaging	0.78
IGL00978:Ttll5	APN	12	85933482	nonsense	probably null
IGL00990:Ttll5	APN	12	85876589	missense	probably damaging	1.00
IGL01726:Ttll5	APN	12	85918934	missense	probably benign	0.30
IGL01797:Ttll5	APN	12	85956597	missense	possibly damaging	0.54
IGL02008:Ttll5	APN	12	85933611	missense	probably damaging	1.00
IGL02210:Ttll5	APN	12	85912545	intron	probably benign
IGL02979:Ttll5	APN	12	85826582	missense	probably damaging	1.00
IGL03079:Ttll5	APN	12	85876558	missense	probably damaging	1.00
IGL03149:Ttll5	APN	12	85918984	missense	probably damaging	0.98
G4846:Ttll5	UTSW	12	86024244	missense	probably damaging	0.99
PIT4812001:Ttll5	UTSW	12	85926861	missense	probably benign	0.12
R0045:Ttll5	UTSW	12	85879359	splice site	probably benign
R0153:Ttll5	UTSW	12	85831966	missense	probably damaging	1.00
R0282:Ttll5	UTSW	12	85996053	missense	probably benign	0.12
R0318:Ttll5	UTSW	12	85876594	critical splice donor site	probably null
R0465:Ttll5	UTSW	12	85933326	missense	probably benign	0.42
R0540:Ttll5	UTSW	12	85933676	critical splice donor site	probably null
R1086:Ttll5	UTSW	12	85891079	missense	possibly damaging	0.66
R1467:Ttll5	UTSW	12	85918962	splice site	probably null
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1505:Ttll5	UTSW	12	85879410	missense	probably damaging	1.00
R1524:Ttll5	UTSW	12	85864568	nonsense	probably null
R1540:Ttll5	UTSW	12	85892208	nonsense	probably null
R1598:Ttll5	UTSW	12	85863598	missense	probably damaging	0.98
R1649:Ttll5	UTSW	12	85923014	missense	probably damaging	1.00
R1774:Ttll5	UTSW	12	85933402	missense	probably benign	0.09
R2340:Ttll5	UTSW	12	85892148	missense	probably benign	0.02
R4094:Ttll5	UTSW	12	85956602	nonsense	probably null
R4095:Ttll5	UTSW	12	85956602	nonsense	probably null
R4908:Ttll5	UTSW	12	85919174	missense	probably benign	0.31
R5012:Ttll5	UTSW	12	85926844	missense	possibly damaging	0.93
R5137:Ttll5	UTSW	12	85923045	missense	possibly damaging	0.83
R5416:Ttll5	UTSW	12	86012828	missense	possibly damaging	0.77
R5773:Ttll5	UTSW	12	85933555	frame shift	probably null
R5774:Ttll5	UTSW	12	85933555	frame shift	probably null
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6173:Ttll5	UTSW	12	85933377	missense	probably damaging	0.99
R6343:Ttll5	UTSW	12	85956699	missense	probably benign	0.00
R6449:Ttll5	UTSW	12	86024276	missense	probably benign	0.00
R6750:Ttll5	UTSW	12	85956610	missense	probably damaging	0.98
R6802:Ttll5	UTSW	12	85879386	missense	probably damaging	1.00
R6825:Ttll5	UTSW	12	85883328	splice site	probably null
R6955:Ttll5	UTSW	12	85864579	missense	possibly damaging	0.91
R7098:Ttll5	UTSW	12	85917673	critical splice acceptor site	probably null
R7154:Ttll5	UTSW	12	85925764	missense	probably damaging	0.98
R7215:Ttll5	UTSW	12	85933396	missense	probably benign	0.02
R7339:Ttll5	UTSW	12	85857464	critical splice donor site	probably null
R7520:Ttll5	UTSW	12	85899471	missense	probably damaging	1.00
R7728:Ttll5	UTSW	12	85956632	missense	probably benign	0.02
R7894:Ttll5	UTSW	12	85889174	missense	probably damaging	1.00
R8119:Ttll5	UTSW	12	86020548	missense	probably damaging	0.98
R8129:Ttll5	UTSW	12	85891084	critical splice donor site	probably null
R8200:Ttll5	UTSW	12	85879410	missense	probably damaging	1.00
R8357:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00
R8413:Ttll5	UTSW	12	85919121	missense	probably benign	0.00
R8457:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00
R9086:Ttll5	UTSW	12	85917742	missense	possibly damaging	0.94
R9086:Ttll5	UTSW	12	86024333	missense	probably benign
R9265:Ttll5	UTSW	12	85891021	nonsense	probably null
R9293:Ttll5	UTSW	12	85891032	missense	probably damaging	1.00
R9302:Ttll5	UTSW	12	85826564	missense	possibly damaging	0.63
R9621:Ttll5	UTSW	12	85892122	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- CACACAGCCAGGAGTGATGATG -3'
(R):5'- TTGGCACCACTTGACATCAG -3'

Sequencing Primer
(F):5'- CCAGGAGTGATGATGGAACTCTCC -3'
(R):5'- CACCACTTGACATCAGGTATTGGG -3'

Posted On

2015-04-30