Mutagenetix > Incidental Mutation

Incidental Mutation 'R1505:Ttll5'

169129

Institutional Source

Beutler Lab

Gene Symbol

Ttll5

Ensembl Gene

ENSMUSG00000012609

Gene Name

tubulin tyrosine ligase-like family, member 5

Synonyms

STAMP

MMRRC Submission

040868-MU

Accession Numbers

Genbank: NM_001081423

Is this an essential gene?

Possibly non essential (E-score: 0.479) question?

Stock #

R1505 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85824659-86061893 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85879410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 326 (I326N)

Ref Sequence

ENSEMBL: ENSMUSP00000039939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110220] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]

AlphaFold

Q8CHB8

Predicted Effect

probably damaging
Transcript: ENSMUST00000040179
AA Change: I326N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1.9e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000040273
AA Change: I326N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000095536
AA Change: I326N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.2e-95	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110220
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105849
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	348	3.5e-72	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110224
AA Change: I326N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	543	562	N/A	INTRINSIC
low complexity region	582	608	N/A	INTRINSIC
low complexity region	734	748	N/A	INTRINSIC
low complexity region	768	780	N/A	INTRINSIC
low complexity region	822	834	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000155448
AA Change: I326N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	6.4e-95	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175899

Predicted Effect

probably damaging
Transcript: ENSMUST00000176695
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177114
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: I326N

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.5%
20x: 86.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	A	5: 104,951,565	R444W	probably damaging	Het
Adnp	A	G	2: 168,183,741	S545P	possibly damaging	Het
Ankrd17	T	C	5: 90,300,026	R219G	possibly damaging	Het
Ap2m1	C	G	16: 20,542,697	P372A	probably benign	Het
Calml3	T	A	13: 3,804,071	T45S	probably benign	Het
Casp8	A	G	1: 58,828,922	E174G	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap221	A	C	1: 119,953,628	L368R	probably benign	Het
Chd9	A	G	8: 91,006,495		probably null	Het
Cnot1	A	T	8: 95,728,667	I2035N	probably damaging	Het
Cyp2c67	T	C	19: 39,648,964	R23G	probably benign	Het
Dnah10	A	C	5: 124,754,239	H777P	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam162b	G	A	10: 51,587,202	A123V	probably damaging	Het
Golgb1	T	A	16: 36,919,643	N2781K	possibly damaging	Het
Hs2st1	C	A	3: 144,434,561	R333L	probably benign	Het
Kmt2e	A	G	5: 23,500,535	H1319R	probably null	Het
Necab1	A	T	4: 14,960,047	M300K	probably benign	Het
Ntrk3	T	A	7: 78,460,524	I321F	probably damaging	Het
Olfr228	A	T	2: 86,483,213	H176Q	possibly damaging	Het
Olfr484	A	G	7: 108,124,993	V90A	probably benign	Het
Olfr860	A	T	9: 19,845,788	M277K	probably benign	Het
Olfr965	A	G	9: 39,719,478	N84D	probably damaging	Het
Osbpl6	T	C	2: 76,579,242	S483P	probably damaging	Het
Pcdhb17	A	C	18: 37,486,822	N555T	probably damaging	Het
Pdgfc	G	A	3: 81,209,236	R299H	possibly damaging	Het
Ptpn7	A	T	1: 135,134,564	T83S	probably benign	Het
Rapgef5	T	C	12: 117,688,619	V79A	possibly damaging	Het
Rexo5	T	A	7: 119,799,603	C54*	probably null	Het
Riok3	A	G	18: 12,152,878	K418R	probably benign	Het
Robo4	G	A	9: 37,403,227	G170D	probably damaging	Het
Rpl8	A	G	15: 76,904,410	D33G	possibly damaging	Het
Rspo2	T	C	15: 43,075,843	T184A	probably damaging	Het
Ryr2	A	T	13: 11,554,592	M4942K	possibly damaging	Het
Sel1l	T	C	12: 91,813,962	Y585C	probably damaging	Het
Slc25a11	G	T	11: 70,646,824	D13E	probably benign	Het
Slc5a6	G	T	5: 31,037,111	H584N	probably benign	Het
Snrpf	A	G	10: 93,583,519	V69A	possibly damaging	Het
Sorbs3	T	A	14: 70,190,802	K475*	probably null	Het
Speg	G	A	1: 75,375,542	V35I	probably benign	Het
Tlk2	T	G	11: 105,260,295	V468G	probably damaging	Het
Trim6	T	A	7: 104,232,564	W341R	probably damaging	Het
Vipas39	T	C	12: 87,246,160	Y318C	probably damaging	Het
Vmn1r185	T	A	7: 26,611,478	I201F	probably damaging	Het
Vwce	A	G	19: 10,664,244	H778R	probably benign	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het

Other mutations in Ttll5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Ttll5	APN	12	85843826	missense	probably damaging	1.00
IGL00932:Ttll5	APN	12	85929907	missense	probably damaging	1.00
IGL00964:Ttll5	APN	12	85849283	missense	possibly damaging	0.78
IGL00978:Ttll5	APN	12	85933482	nonsense	probably null
IGL00990:Ttll5	APN	12	85876589	missense	probably damaging	1.00
IGL01726:Ttll5	APN	12	85918934	missense	probably benign	0.30
IGL01797:Ttll5	APN	12	85956597	missense	possibly damaging	0.54
IGL02008:Ttll5	APN	12	85933611	missense	probably damaging	1.00
IGL02210:Ttll5	APN	12	85912545	intron	probably benign
IGL02979:Ttll5	APN	12	85826582	missense	probably damaging	1.00
IGL03079:Ttll5	APN	12	85876558	missense	probably damaging	1.00
IGL03149:Ttll5	APN	12	85918984	missense	probably damaging	0.98
G4846:Ttll5	UTSW	12	86024244	missense	probably damaging	0.99
PIT4812001:Ttll5	UTSW	12	85926861	missense	probably benign	0.12
R0045:Ttll5	UTSW	12	85879359	splice site	probably benign
R0153:Ttll5	UTSW	12	85831966	missense	probably damaging	1.00
R0282:Ttll5	UTSW	12	85996053	missense	probably benign	0.12
R0318:Ttll5	UTSW	12	85876594	critical splice donor site	probably null
R0465:Ttll5	UTSW	12	85933326	missense	probably benign	0.42
R0540:Ttll5	UTSW	12	85933676	critical splice donor site	probably null
R1086:Ttll5	UTSW	12	85891079	missense	possibly damaging	0.66
R1467:Ttll5	UTSW	12	85918962	splice site	probably null
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1524:Ttll5	UTSW	12	85864568	nonsense	probably null
R1540:Ttll5	UTSW	12	85892208	nonsense	probably null
R1598:Ttll5	UTSW	12	85863598	missense	probably damaging	0.98
R1649:Ttll5	UTSW	12	85923014	missense	probably damaging	1.00
R1774:Ttll5	UTSW	12	85933402	missense	probably benign	0.09
R2340:Ttll5	UTSW	12	85892148	missense	probably benign	0.02
R4049:Ttll5	UTSW	12	86012799	missense	probably benign	0.01
R4094:Ttll5	UTSW	12	85956602	nonsense	probably null
R4095:Ttll5	UTSW	12	85956602	nonsense	probably null
R4908:Ttll5	UTSW	12	85919174	missense	probably benign	0.31
R5012:Ttll5	UTSW	12	85926844	missense	possibly damaging	0.93
R5137:Ttll5	UTSW	12	85923045	missense	possibly damaging	0.83
R5416:Ttll5	UTSW	12	86012828	missense	possibly damaging	0.77
R5773:Ttll5	UTSW	12	85933555	frame shift	probably null
R5774:Ttll5	UTSW	12	85933555	frame shift	probably null
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6173:Ttll5	UTSW	12	85933377	missense	probably damaging	0.99
R6343:Ttll5	UTSW	12	85956699	missense	probably benign	0.00
R6449:Ttll5	UTSW	12	86024276	missense	probably benign	0.00
R6750:Ttll5	UTSW	12	85956610	missense	probably damaging	0.98
R6802:Ttll5	UTSW	12	85879386	missense	probably damaging	1.00
R6825:Ttll5	UTSW	12	85883328	splice site	probably null
R6955:Ttll5	UTSW	12	85864579	missense	possibly damaging	0.91
R7098:Ttll5	UTSW	12	85917673	critical splice acceptor site	probably null
R7154:Ttll5	UTSW	12	85925764	missense	probably damaging	0.98
R7215:Ttll5	UTSW	12	85933396	missense	probably benign	0.02
R7339:Ttll5	UTSW	12	85857464	critical splice donor site	probably null
R7520:Ttll5	UTSW	12	85899471	missense	probably damaging	1.00
R7728:Ttll5	UTSW	12	85956632	missense	probably benign	0.02
R7894:Ttll5	UTSW	12	85889174	missense	probably damaging	1.00
R8119:Ttll5	UTSW	12	86020548	missense	probably damaging	0.98
R8129:Ttll5	UTSW	12	85891084	critical splice donor site	probably null
R8200:Ttll5	UTSW	12	85879410	missense	probably damaging	1.00
R8357:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00
R8413:Ttll5	UTSW	12	85919121	missense	probably benign	0.00
R8457:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00
R9086:Ttll5	UTSW	12	85917742	missense	possibly damaging	0.94
R9086:Ttll5	UTSW	12	86024333	missense	probably benign
R9265:Ttll5	UTSW	12	85891021	nonsense	probably null
R9293:Ttll5	UTSW	12	85891032	missense	probably damaging	1.00
R9302:Ttll5	UTSW	12	85826564	missense	possibly damaging	0.63
R9621:Ttll5	UTSW	12	85892122	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- ACAGACTGTTCATGCACAGGGAAAG -3'
(R):5'- TCCTGGAGAAATCACTATGCCCCAC -3'

Sequencing Primer
(F):5'- TGTAGCACCCGGACTGAAG -3'
(R):5'- TATGCCCCACTAGCTGAGG -3'

Posted On

2014-04-13