Incidental Mutation 'R1505:Ttll5'
ID 169129
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Name tubulin tyrosine ligase-like family, member 5
Synonyms STAMP
MMRRC Submission 040868-MU
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock # R1505 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 85824659-86061893 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85879410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 326 (I326N)
Ref Sequence ENSEMBL: ENSMUSP00000039939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110220] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
AlphaFold Q8CHB8
Predicted Effect probably damaging
Transcript: ENSMUST00000040179
AA Change: I326N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000040273
AA Change: I326N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095536
AA Change: I326N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.2e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110220
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105849
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 348 3.5e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110224
AA Change: I326N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155448
AA Change: I326N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175899
Predicted Effect probably damaging
Transcript: ENSMUST00000176695
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177114
AA Change: I326N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: I326N

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.5%
  • 20x: 86.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T A 5: 104,951,565 R444W probably damaging Het
Adnp A G 2: 168,183,741 S545P possibly damaging Het
Ankrd17 T C 5: 90,300,026 R219G possibly damaging Het
Ap2m1 C G 16: 20,542,697 P372A probably benign Het
Calml3 T A 13: 3,804,071 T45S probably benign Het
Casp8 A G 1: 58,828,922 E174G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap221 A C 1: 119,953,628 L368R probably benign Het
Chd9 A G 8: 91,006,495 probably null Het
Cnot1 A T 8: 95,728,667 I2035N probably damaging Het
Cyp2c67 T C 19: 39,648,964 R23G probably benign Het
Dnah10 A C 5: 124,754,239 H777P possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam162b G A 10: 51,587,202 A123V probably damaging Het
Golgb1 T A 16: 36,919,643 N2781K possibly damaging Het
Hs2st1 C A 3: 144,434,561 R333L probably benign Het
Kmt2e A G 5: 23,500,535 H1319R probably null Het
Necab1 A T 4: 14,960,047 M300K probably benign Het
Ntrk3 T A 7: 78,460,524 I321F probably damaging Het
Olfr228 A T 2: 86,483,213 H176Q possibly damaging Het
Olfr484 A G 7: 108,124,993 V90A probably benign Het
Olfr860 A T 9: 19,845,788 M277K probably benign Het
Olfr965 A G 9: 39,719,478 N84D probably damaging Het
Osbpl6 T C 2: 76,579,242 S483P probably damaging Het
Pcdhb17 A C 18: 37,486,822 N555T probably damaging Het
Pdgfc G A 3: 81,209,236 R299H possibly damaging Het
Ptpn7 A T 1: 135,134,564 T83S probably benign Het
Rapgef5 T C 12: 117,688,619 V79A possibly damaging Het
Rexo5 T A 7: 119,799,603 C54* probably null Het
Riok3 A G 18: 12,152,878 K418R probably benign Het
Robo4 G A 9: 37,403,227 G170D probably damaging Het
Rpl8 A G 15: 76,904,410 D33G possibly damaging Het
Rspo2 T C 15: 43,075,843 T184A probably damaging Het
Ryr2 A T 13: 11,554,592 M4942K possibly damaging Het
Sel1l T C 12: 91,813,962 Y585C probably damaging Het
Slc25a11 G T 11: 70,646,824 D13E probably benign Het
Slc5a6 G T 5: 31,037,111 H584N probably benign Het
Snrpf A G 10: 93,583,519 V69A possibly damaging Het
Sorbs3 T A 14: 70,190,802 K475* probably null Het
Speg G A 1: 75,375,542 V35I probably benign Het
Tlk2 T G 11: 105,260,295 V468G probably damaging Het
Trim6 T A 7: 104,232,564 W341R probably damaging Het
Vipas39 T C 12: 87,246,160 Y318C probably damaging Het
Vmn1r185 T A 7: 26,611,478 I201F probably damaging Het
Vwce A G 19: 10,664,244 H778R probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 splice site probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
R7894:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
R8119:Ttll5 UTSW 12 86020548 missense probably damaging 0.98
R8129:Ttll5 UTSW 12 85891084 critical splice donor site probably null
R8200:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R8357:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
R8413:Ttll5 UTSW 12 85919121 missense probably benign 0.00
R8457:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
R9086:Ttll5 UTSW 12 85917742 missense possibly damaging 0.94
R9086:Ttll5 UTSW 12 86024333 missense probably benign
R9265:Ttll5 UTSW 12 85891021 nonsense probably null
R9293:Ttll5 UTSW 12 85891032 missense probably damaging 1.00
R9302:Ttll5 UTSW 12 85826564 missense possibly damaging 0.63
R9621:Ttll5 UTSW 12 85892122 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACAGACTGTTCATGCACAGGGAAAG -3'
(R):5'- TCCTGGAGAAATCACTATGCCCCAC -3'

Sequencing Primer
(F):5'- TGTAGCACCCGGACTGAAG -3'
(R):5'- TATGCCCCACTAGCTGAGG -3'
Posted On 2014-04-13