Incidental Mutation 'R1659:Hcn1'
ID186617
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
MMRRC Submission 039695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1659 (G1)
Quality Score186
Status Not validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117976074 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 858 (Q858L)
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000006991
AA Change: Q858L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: Q858L

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,064,633 L87Q probably damaging Het
Atp13a5 T G 16: 29,293,433 D630A probably benign Het
Brd7 G T 8: 88,333,792 P568T probably damaging Het
Ccdc141 A G 2: 77,054,683 L538P probably benign Het
Cd177 G T 7: 24,746,137 T627K probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdhr2 T A 13: 54,719,761 I468N probably damaging Het
Cdk14 T C 5: 4,949,571 T338A probably benign Het
Celsr2 G A 3: 108,414,095 T467I probably benign Het
Chrd A G 16: 20,735,831 E380G probably damaging Het
Cnnm4 C A 1: 36,472,165 T158N probably benign Het
Ddx51 T A 5: 110,655,120 I254N probably damaging Het
Deptor G A 15: 55,218,274 probably null Het
Dnah11 T A 12: 118,120,724 H1215L possibly damaging Het
Dock1 A G 7: 134,789,243 Y744C probably damaging Het
Dok7 C T 5: 35,079,139 T257I possibly damaging Het
Eif4g1 T C 16: 20,681,061 Y591H probably damaging Het
Fat3 T C 9: 15,997,183 T2508A possibly damaging Het
Gm266 A G 12: 111,485,289 V161A probably damaging Het
Golgb1 A G 16: 36,887,617 I107V probably benign Het
Gpnmb T C 6: 49,047,852 F273L probably damaging Het
Hcrtr1 G T 4: 130,135,336 Y224* probably null Het
Hepacam A G 9: 37,380,658 D94G probably benign Het
Herc2 T A 7: 56,135,105 H1432Q probably benign Het
Il20 T A 1: 130,908,349 probably null Het
Itga10 A G 3: 96,662,977 T1150A probably damaging Het
Itgax C T 7: 128,130,891 T73I probably benign Het
Kdm6b T A 11: 69,407,588 Q98L possibly damaging Het
Lrrc7 A G 3: 158,161,408 W899R probably damaging Het
Meikin C A 11: 54,390,566 S154* probably null Het
Mrgprg A T 7: 143,764,551 S275T possibly damaging Het
Mstn C T 1: 53,064,077 R191* probably null Het
Neu3 A G 7: 99,813,433 I361T probably damaging Het
Nrxn3 A G 12: 90,332,391 D425G probably damaging Het
Nup205 T A 6: 35,234,788 M1688K probably benign Het
Olfr412 A T 11: 74,364,933 Q88L probably benign Het
Olfr665 A G 7: 104,881,180 M158V probably benign Het
Omg C T 11: 79,502,900 C44Y possibly damaging Het
Pcdh8 T C 14: 79,768,134 D938G probably damaging Het
Pp2d1 T C 17: 53,515,378 D220G possibly damaging Het
Prune2 C T 19: 17,120,651 T1173I possibly damaging Het
Rbfox3 T C 11: 118,494,155 T359A probably damaging Het
Rhpn2 A G 7: 35,377,041 Y339C probably damaging Het
Rpl7a-ps3 A G 15: 36,308,163 noncoding transcript Het
Sars T C 3: 108,429,416 E217G probably damaging Het
Sec61a2 A G 2: 5,886,534 F62S possibly damaging Het
Slc12a7 T A 13: 73,790,671 I189N probably damaging Het
Slc5a10 G A 11: 61,676,244 A375V possibly damaging Het
Srfbp1 C T 18: 52,488,895 H343Y possibly damaging Het
Tbck T G 3: 132,734,355 I486M probably damaging Het
Thra G A 11: 98,756,979 A60T probably damaging Het
Thsd7a T A 6: 12,504,064 T364S possibly damaging Het
Ttc16 C T 2: 32,762,535 D761N probably benign Het
Vwa7 T C 17: 35,019,071 L216P probably benign Het
Ydjc T C 16: 17,147,839 V156A possibly damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
PIT4504001:Hcn1 UTSW 13 117975875 missense possibly damaging 0.90
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
R7049:Hcn1 UTSW 13 117975462 missense unknown
R7163:Hcn1 UTSW 13 117925547 missense unknown
R7534:Hcn1 UTSW 13 117975425 missense unknown
R7722:Hcn1 UTSW 13 117902778 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGAAGTCAGGCCCCTTTCCGC -3'
(R):5'- CTAGACGCAGAGGCACAGCTAATG -3'

Sequencing Primer
(F):5'- GCCTCGCAGCCTTCTCTG -3'
(R):5'- TCAGAGTAGGCTATAGGGATCTATC -3'
Posted On2014-05-09