Mutagenetix > Incidental Mutations

Incidental Mutation 'R1667:Hcn1'

187313

Institutional Source

Beutler Lab

Gene Symbol

Hcn1

Ensembl Gene

ENSMUSG00000021730

Gene Name

hyperpolarization-activated, cyclic nucleotide-gated K+ 1

Synonyms

HAC2, Bcng1, C630013B14Rik

MMRRC Submission

039703-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1667 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117602320-117987418 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117603073 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 124 (I124F)

Ref Sequence

ENSEMBL: ENSMUSP00000006991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006991]

PDB Structure

Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]

Predicted Effect

unknown
Transcript: ENSMUST00000006991
AA Change: I124F

SMART Domains

Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: I124F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans_N	87	130	8.2e-24	PFAM
Pfam:Ion_trans	131	394	2.1e-23	PFAM
low complexity region	395	406	N/A	INTRINSIC
Blast:cNMP	407	439	4e-13	BLAST
cNMP	464	580	1.95e-22	SMART
low complexity region	639	655	N/A	INTRINSIC
low complexity region	660	680	N/A	INTRINSIC
low complexity region	720	779	N/A	INTRINSIC
low complexity region	878	886	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207599

Meta Mutation Damage Score

0.8385

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

99% (76/77)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgra1	G	A	7: 139,845,648	A26T	possibly damaging	Het
Adgrg3	T	A	8: 95,033,373	Y73*	probably null	Het
Alk	A	T	17: 71,911,567	V761E	probably damaging	Het
Ankrd13a	T	C	5: 114,786,733	V93A	possibly damaging	Het
Anks1b	T	C	10: 90,511,184		probably null	Het
Ascl1	T	C	10: 87,492,793	N99S	probably benign	Het
Atm	A	T	9: 53,500,932	L972Q	probably damaging	Het
Atp2c1	A	T	9: 105,432,797	L566Q	probably null	Het
Bank1	T	A	3: 136,093,296	Y629F	probably damaging	Het
Bod1l	G	T	5: 41,816,775	L2399I	probably benign	Het
Bub1b	G	A	2: 118,641,189	G1010D	probably benign	Het
Ces1b	G	A	8: 93,056,904	H563Y	possibly damaging	Het
Cfap70	T	C	14: 20,404,157	E853G	probably benign	Het
Cfh	T	C	1: 140,105,523	E779G	probably benign	Het
Cox7c	A	G	13: 86,045,884	S7P	probably benign	Het
Cyp2c67	A	G	19: 39,643,590		probably null	Het
Dhx30	G	T	9: 110,085,445	L995I	possibly damaging	Het
Dhx30	G	C	9: 110,085,446	N957K	possibly damaging	Het
Dsc3	T	C	18: 19,991,560	T36A	possibly damaging	Het
Dstyk	A	G	1: 132,456,919	D717G	probably damaging	Het
Dusp10	A	G	1: 184,036,858	D7G	probably damaging	Het
E230001N04Rik	T	G	17: 28,523,961		noncoding transcript	Het
Ece2	T	C	16: 20,637,838	S330P	possibly damaging	Het
Fam172a	T	A	13: 77,759,516	M1K	probably null	Het
Frmd5	ATAGTGGAATTGTTCAAACTC	ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC	2: 121,548,730		probably null	Het
Gata3	T	C	2: 9,877,549	H14R	possibly damaging	Het
Ggta1	T	A	2: 35,414,283	I75F	possibly damaging	Het
Herpud1	A	C	8: 94,389,366	D53A	probably damaging	Het
Inhba	T	A	13: 16,026,624	L257Q	possibly damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Jmy	T	A	13: 93,498,370	S313C	probably damaging	Het
Lpo	G	A	11: 87,807,241		probably benign	Het
Lsg1	T	C	16: 30,571,352	E315G	probably damaging	Het
Lsm14a	T	A	7: 34,365,654	T167S	possibly damaging	Het
Lsmem1	GTACATACATACATACATACATACATACA	GTACATACATACATACATACATACATACATACA	12: 40,185,261		probably null	Het
Map3k2	T	C	18: 32,203,792		probably benign	Het
Mapk12	A	T	15: 89,140,141	M81K	probably damaging	Het
Matn2	T	A	15: 34,378,732	C305S	probably damaging	Het
Mgam	T	C	6: 40,677,044	Y844H	possibly damaging	Het
Mgat5b	A	G	11: 116,947,377	R281G	probably benign	Het
Mon1b	T	G	8: 113,641,957	C497G	probably damaging	Het
Mybbp1a	A	T	11: 72,445,217	H452L	probably benign	Het
Mybl2	A	G	2: 163,075,696	T41A	probably damaging	Het
Ncoa5	A	G	2: 165,001,703	V540A	probably damaging	Het
Nup93	T	A	8: 94,292,687	V47E	possibly damaging	Het
Olfr1052	A	G	2: 86,298,736	M307V	probably null	Het
Olfr17	A	T	7: 107,097,770	M102L	probably benign	Het
Orc6	T	A	8: 85,305,285	C100S	possibly damaging	Het
Otogl	G	T	10: 107,813,965	Y1176*	probably null	Het
Patj	A	T	4: 98,413,027	D183V	probably damaging	Het
Pik3r3	A	G	4: 116,222,317	T4A	probably damaging	Het
Pla2g4d	G	A	2: 120,270,150		probably benign	Het
Pla2r1	A	G	2: 60,420,257	I1407T	probably benign	Het
Pramef12	A	T	4: 144,393,036	C320*	probably null	Het
Prex2	A	T	1: 11,186,757	H1231L	probably benign	Het
Prkca	A	G	11: 107,983,946	V390A	probably damaging	Het
Psmd13	T	A	7: 140,890,609	W255R	probably damaging	Het
Rec8	T	A	14: 55,618,796	N37K	probably damaging	Het
Rnf207	C	T	4: 152,313,215	E361K	probably benign	Het
Serpina3f	T	A	12: 104,217,440	L187Q	probably damaging	Het
Skint11	A	T	4: 114,194,781	T109S	probably damaging	Het
Slc7a8	A	G	14: 54,724,849	S443P	probably damaging	Het
Slc8b1	T	A	5: 120,521,082	F197Y	probably benign	Het
Sox2	T	C	3: 34,650,419	Y2H	probably damaging	Het
Speg	T	A	1: 75,410,549		probably benign	Het
Tlr3	T	C	8: 45,400,837	N149D	probably benign	Het
Trim60	A	C	8: 65,001,464	D44E	probably benign	Het
Ugt1a7c	A	G	1: 88,095,935	Y272C	probably damaging	Het
Vmn1r4	T	A	6: 56,956,753	Y81N	probably damaging	Het
Vmn2r73	A	T	7: 85,857,681	C808S	probably benign	Het
Ythdf3	T	C	3: 16,204,892	I412T	possibly damaging	Het
Zfp672	T	C	11: 58,316,095	T467A	possibly damaging	Het
Zfp985	A	T	4: 147,583,950	Q425L	possibly damaging	Het

Other mutations in Hcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Hcn1	APN	13	117975993	missense	probably damaging	1.00
IGL00340:Hcn1	APN	13	117602977	missense	unknown
IGL01161:Hcn1	APN	13	117656922	missense	unknown
IGL01723:Hcn1	APN	13	117976055	missense	probably damaging	0.98
IGL02324:Hcn1	APN	13	117902886	missense	unknown
IGL02491:Hcn1	APN	13	117810040	missense	unknown
Thump	UTSW	13	117873905	nonsense	probably null
FR4976:Hcn1	UTSW	13	117975808	small insertion	probably benign
PIT4504001:Hcn1	UTSW	13	117975875	missense	possibly damaging	0.90
R0420:Hcn1	UTSW	13	117975375	missense	unknown
R1546:Hcn1	UTSW	13	117975766	small insertion	probably benign
R1558:Hcn1	UTSW	13	117975576	missense	unknown
R1659:Hcn1	UTSW	13	117976074	missense	probably damaging	0.99
R1766:Hcn1	UTSW	13	117656734	missense	probably benign	0.39
R1842:Hcn1	UTSW	13	117976008	missense	probably damaging	0.99
R2051:Hcn1	UTSW	13	117976083	missense	probably damaging	0.99
R3605:Hcn1	UTSW	13	117975252	missense	unknown
R4259:Hcn1	UTSW	13	117975348	missense	unknown
R4284:Hcn1	UTSW	13	117975733	small deletion	probably benign
R4637:Hcn1	UTSW	13	117975713	missense	unknown
R4679:Hcn1	UTSW	13	117657015	missense	probably benign	0.39
R4777:Hcn1	UTSW	13	117975733	small deletion	probably benign
R4839:Hcn1	UTSW	13	117925710	missense	unknown
R4883:Hcn1	UTSW	13	117902895	critical splice donor site	probably null
R5015:Hcn1	UTSW	13	117603020	missense	unknown
R5060:Hcn1	UTSW	13	117873905	nonsense	probably null
R5748:Hcn1	UTSW	13	117976055	missense	probably damaging	0.99
R5823:Hcn1	UTSW	13	117602852	missense	unknown
R6900:Hcn1	UTSW	13	117656827	missense	probably benign	0.39
R7045:Hcn1	UTSW	13	117975462	missense	unknown
R7049:Hcn1	UTSW	13	117975462	missense	unknown
R7163:Hcn1	UTSW	13	117925547	missense	unknown
R7534:Hcn1	UTSW	13	117975425	missense	unknown
R7722:Hcn1	UTSW	13	117902778	missense	unknown
R7984:Hcn1	UTSW	13	117976073	nonsense	probably null
R8083:Hcn1	UTSW	13	117975760	small insertion	probably benign
R8171:Hcn1	UTSW	13	117602734	missense	unknown
R8223:Hcn1	UTSW	13	117873870	missense	unknown
R8240:Hcn1	UTSW	13	117975733	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGCAACTCCGTGTGCTTCAAG -3'
(R):5'- TGCTGTCCCCAAAGTTCACCAG -3'

Sequencing Primer
(F):5'- TGCTTCAAGGTGGACGGC -3'
(R):5'- ACCCTAAACCTGTCGTCGG -3'

Posted On

2014-05-09