Incidental Mutation 'R1709:Nup153'
ID190355
Institutional Source Beutler Lab
Gene Symbol Nup153
Ensembl Gene ENSMUSG00000021374
Gene Namenucleoporin 153
SynonymsB130015D15Rik
MMRRC Submission 039742-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R1709 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location46679905-46727940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46693974 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 660 (C660R)
Ref Sequence ENSEMBL: ENSMUSP00000021803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021803]
Predicted Effect probably damaging
Transcript: ENSMUST00000021803
AA Change: C660R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021803
Gene: ENSMUSG00000021374
AA Change: C660R

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Nup153 114 627 6e-236 PFAM
ZnF_RBZ 656 680 6.56e-6 SMART
ZnF_RBZ 719 743 5.89e-8 SMART
low complexity region 756 775 N/A INTRINSIC
ZnF_RBZ 787 811 7.2e-3 SMART
low complexity region 815 830 N/A INTRINSIC
ZnF_RBZ 844 868 1.64e-6 SMART
low complexity region 898 911 N/A INTRINSIC
low complexity region 1078 1085 N/A INTRINSIC
low complexity region 1183 1207 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1271 1296 N/A INTRINSIC
Pfam:Nup_retrotrp_bd 1372 1462 4.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224186
Predicted Effect unknown
Transcript: ENSMUST00000224203
AA Change: C44R
Predicted Effect probably benign
Transcript: ENSMUST00000225894
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik C T 5: 9,440,726 R579* probably null Het
Aacs A G 5: 125,489,878 K152E probably benign Het
Adgrd1 T C 5: 129,179,228 V641A possibly damaging Het
Adgrv1 A T 13: 81,593,060 V95E probably damaging Het
Agbl5 G A 5: 30,906,241 C872Y probably damaging Het
Aldh1a7 G T 19: 20,715,952 T201K probably damaging Het
Aox1 C T 1: 58,077,474 A788V probably benign Het
Apob T C 12: 8,009,306 V2563A probably damaging Het
Atcay G A 10: 81,213,231 T179I probably damaging Het
Atf5 A T 7: 44,813,283 L139Q probably benign Het
Atp13a3 T C 16: 30,315,841 T1205A probably benign Het
Atr C T 9: 95,871,076 T656I probably benign Het
Bloc1s3 T C 7: 19,507,528 E25G possibly damaging Het
Brap T C 5: 121,665,290 probably null Het
C6 G T 15: 4,790,970 A488S probably benign Het
Ccin T C 4: 43,984,133 F180S probably damaging Het
Cd207 T C 6: 83,672,836 I256V possibly damaging Het
Cdc42bpa G T 1: 180,067,224 C323F probably damaging Het
Cfap57 T C 4: 118,571,704 T1022A probably benign Het
Cmtr2 A T 8: 110,221,949 Q297L probably benign Het
Coro7 A T 16: 4,634,441 probably null Het
Cpsf2 T A 12: 101,999,542 Y589N probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Crocc A G 4: 141,026,099 probably null Het
Cryzl1 A C 16: 91,712,236 F59C probably damaging Het
Csmd2 T C 4: 128,496,195 V2241A probably damaging Het
Cxcl15 C A 5: 90,801,416 H147N unknown Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dnah10 C T 5: 124,760,091 P966L probably damaging Het
Dpp9 T A 17: 56,194,431 M594L probably benign Het
Dspp C A 5: 104,175,724 N244K probably damaging Het
Efcab8 T A 2: 153,814,370 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw17 A G 13: 50,431,657 M299V probably benign Het
Fbxw7 T A 3: 84,976,352 I530N probably damaging Het
Gm13023 T C 4: 143,793,546 V120A possibly damaging Het
Gp2 C A 7: 119,451,585 D308Y probably null Het
Gpd2 G A 2: 57,357,655 V537M probably damaging Het
Gpr18 T A 14: 121,911,992 Y207F probably damaging Het
Grip1 A T 10: 119,897,715 D20V probably damaging Het
Gzmf A C 14: 56,206,940 F59V probably damaging Het
Hist1h3a T A 13: 23,761,981 I125F probably damaging Het
Igfn1 T C 1: 135,955,573 I2732V probably benign Het
Ipo8 A T 6: 148,782,728 D855E probably benign Het
Klrk1 A T 6: 129,614,719 probably null Het
Megf11 A G 9: 64,695,412 Y876C probably damaging Het
Mettl8 G T 2: 70,982,151 Q12K probably benign Het
Mrgprf T C 7: 145,308,217 F172S probably benign Het
Mycbp2 G A 14: 103,224,416 T1432I probably damaging Het
Nek11 A C 9: 105,348,061 L84R probably damaging Het
Nlrp1b T C 11: 71,201,273 E9G probably benign Het
Nrxn1 T C 17: 90,037,187 I433V probably damaging Het
Olfr108 T A 17: 37,446,200 Y226* probably null Het
Olfr1427 G T 19: 12,098,881 P253T probably damaging Het
Olfr196 T A 16: 59,167,901 M81L probably benign Het
Olfr447 T C 6: 42,912,144 V207A possibly damaging Het
P2rx7 T A 5: 122,670,465 N303K possibly damaging Het
Pank4 T C 4: 154,970,047 L159P probably damaging Het
Pcdhb22 A T 18: 37,518,500 H7L probably benign Het
Pdzd8 A T 19: 59,301,339 I543N probably benign Het
Prrc2b C A 2: 32,194,461 R313S probably damaging Het
Rbm12b1 T C 4: 12,145,827 C600R probably benign Het
Rem1 G A 2: 152,634,535 V238M probably damaging Het
Rfx6 T A 10: 51,678,402 M113K possibly damaging Het
Rlf A T 4: 121,149,823 D653E probably benign Het
Rnf130 A G 11: 50,087,386 D258G possibly damaging Het
Robo2 A G 16: 73,956,523 V822A possibly damaging Het
Rps6kc1 G T 1: 190,800,336 Q490K possibly damaging Het
Scn9a T C 2: 66,483,506 Y1945C probably damaging Het
Setd2 T A 9: 110,549,857 D913E probably benign Het
Sfr1 G T 19: 47,735,003 E315D possibly damaging Het
Smarca5 G A 8: 80,709,220 R763* probably null Het
Sugct A C 13: 17,672,566 I44S probably damaging Het
Syce1l A G 8: 113,654,030 probably null Het
Tbc1d8b A G X: 139,734,080 I654V probably benign Het
Tcf23 T A 5: 30,973,508 Y163* probably null Het
Terf2ip TG T 8: 112,011,606 probably null Het
Tmem158 T C 9: 123,259,885 S221G possibly damaging Het
Tnrc6a A G 7: 123,169,982 T332A probably benign Het
Trappc4 T C 9: 44,407,211 T31A probably benign Het
Trim27 T C 13: 21,188,065 probably null Het
Ttyh2 T A 11: 114,708,475 L330Q probably damaging Het
Tubgcp3 A T 8: 12,639,532 L578* probably null Het
Txndc11 C A 16: 11,128,701 E83* probably null Het
Utp20 T C 10: 88,749,297 K2635R probably benign Het
V1ra8 C T 6: 90,203,322 T169I probably damaging Het
Vcl G A 14: 21,019,373 V706I probably benign Het
Vmn2r106 A T 17: 20,279,111 D179E probably benign Het
Vmn2r80 T C 10: 79,194,389 M683T probably benign Het
Xirp2 A G 2: 67,509,871 I819V probably benign Het
Zfp735 T C 11: 73,711,763 F511S probably benign Het
Zfp831 T C 2: 174,645,890 V786A probably benign Het
Zfp992 T A 4: 146,466,492 H223Q probably benign Het
Zfyve19 A C 2: 119,210,819 Q72P probably damaging Het
Other mutations in Nup153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nup153 APN 13 46681150 unclassified probably benign
IGL01312:Nup153 APN 13 46686824 missense probably benign 0.03
IGL01459:Nup153 APN 13 46712926 missense possibly damaging 0.84
IGL01646:Nup153 APN 13 46684107 missense possibly damaging 0.80
IGL03064:Nup153 APN 13 46693839 missense probably benign
IGL03288:Nup153 APN 13 46705205 missense possibly damaging 0.71
IGL03369:Nup153 APN 13 46700983 splice site probably null
IGL03371:Nup153 APN 13 46683152 missense probably benign 0.34
R0193:Nup153 UTSW 13 46709654 missense probably benign 0.01
R0244:Nup153 UTSW 13 46693936 missense probably benign 0.03
R0448:Nup153 UTSW 13 46717181 missense probably benign 0.00
R0943:Nup153 UTSW 13 46696772 splice site probably benign
R1219:Nup153 UTSW 13 46687219 missense probably benign 0.01
R1381:Nup153 UTSW 13 46689181 missense probably damaging 1.00
R1727:Nup153 UTSW 13 46693785 missense probably damaging 1.00
R1818:Nup153 UTSW 13 46681637 missense possibly damaging 0.94
R1824:Nup153 UTSW 13 46713747 missense probably damaging 1.00
R1928:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R2108:Nup153 UTSW 13 46693510 critical splice donor site probably null
R2110:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2111:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2173:Nup153 UTSW 13 46701600 splice site probably benign
R2231:Nup153 UTSW 13 46709627 critical splice donor site probably null
R3879:Nup153 UTSW 13 46683960 missense probably damaging 1.00
R4634:Nup153 UTSW 13 46687230 missense possibly damaging 0.49
R4662:Nup153 UTSW 13 46687274 missense possibly damaging 0.68
R4932:Nup153 UTSW 13 46712737 nonsense probably null
R5011:Nup153 UTSW 13 46687403 missense possibly damaging 0.62
R5023:Nup153 UTSW 13 46681109 unclassified probably benign
R5069:Nup153 UTSW 13 46709792 missense probably benign 0.05
R5137:Nup153 UTSW 13 46684153 missense probably damaging 0.99
R5323:Nup153 UTSW 13 46717206 missense probably benign 0.19
R5345:Nup153 UTSW 13 46686865 nonsense probably null
R5536:Nup153 UTSW 13 46683009 missense probably benign 0.01
R5613:Nup153 UTSW 13 46687271 missense possibly damaging 0.64
R5620:Nup153 UTSW 13 46684006 nonsense probably null
R5764:Nup153 UTSW 13 46687327 missense probably damaging 0.97
R5849:Nup153 UTSW 13 46686976 missense probably damaging 0.99
R6454:Nup153 UTSW 13 46709660 unclassified probably null
R6701:Nup153 UTSW 13 46687065 missense probably benign 0.00
R6721:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R6737:Nup153 UTSW 13 46689206 missense probably benign 0.08
R6789:Nup153 UTSW 13 46717316 missense probably damaging 1.00
R6820:Nup153 UTSW 13 46709983 missense probably benign 0.09
R6837:Nup153 UTSW 13 46694051 missense probably damaging 1.00
R6913:Nup153 UTSW 13 46699716 missense probably damaging 1.00
R7052:Nup153 UTSW 13 46687473 missense probably benign 0.09
R7091:Nup153 UTSW 13 46683928 missense probably benign
R7357:Nup153 UTSW 13 46717166 missense probably benign 0.32
R7389:Nup153 UTSW 13 46700987 critical splice donor site probably null
R7423:Nup153 UTSW 13 46696644 critical splice donor site probably null
R7453:Nup153 UTSW 13 46681181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAATGTAAGGGCTCGCTTCAC -3'
(R):5'- ACTGTAGGTTTCGCATCACCAAAGG -3'

Sequencing Primer
(F):5'- GCTTAGGTGTCTCACAGGCTAC -3'
(R):5'- TCGCATCACCAAAGGTTGATTC -3'
Posted On2014-05-14