Incidental Mutation 'R1709:Dennd4a'
ID 190334
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN/MADD domain containing 4A
Synonyms F730015K02Rik
MMRRC Submission 039742-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.432) question?
Stock # R1709 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 64811340-64919667 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64889605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 860 (T860A)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect possibly damaging
Transcript: ENSMUST00000038890
AA Change: T860A

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: T860A

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216098
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik C T 5: 9,440,726 (GRCm38) R579* probably null Het
Aacs A G 5: 125,489,878 (GRCm38) K152E probably benign Het
Adgrd1 T C 5: 129,179,228 (GRCm38) V641A possibly damaging Het
Adgrv1 A T 13: 81,593,060 (GRCm38) V95E probably damaging Het
Agbl5 G A 5: 30,906,241 (GRCm38) C872Y probably damaging Het
Aldh1a7 G T 19: 20,715,952 (GRCm38) T201K probably damaging Het
Aox1 C T 1: 58,077,474 (GRCm38) A788V probably benign Het
Apob T C 12: 8,009,306 (GRCm38) V2563A probably damaging Het
Atcay G A 10: 81,213,231 (GRCm38) T179I probably damaging Het
Atf5 A T 7: 44,813,283 (GRCm38) L139Q probably benign Het
Atp13a3 T C 16: 30,315,841 (GRCm38) T1205A probably benign Het
Atr C T 9: 95,871,076 (GRCm38) T656I probably benign Het
Bloc1s3 T C 7: 19,507,528 (GRCm38) E25G possibly damaging Het
Brap T C 5: 121,665,290 (GRCm38) probably null Het
C6 G T 15: 4,790,970 (GRCm38) A488S probably benign Het
Ccin T C 4: 43,984,133 (GRCm38) F180S probably damaging Het
Cd207 T C 6: 83,672,836 (GRCm38) I256V possibly damaging Het
Cdc42bpa G T 1: 180,067,224 (GRCm38) C323F probably damaging Het
Cfap57 T C 4: 118,571,704 (GRCm38) T1022A probably benign Het
Cmtr2 A T 8: 110,221,949 (GRCm38) Q297L probably benign Het
Coro7 A T 16: 4,634,441 (GRCm38) probably null Het
Cpsf2 T A 12: 101,999,542 (GRCm38) Y589N probably damaging Het
Cpxm2 T C 7: 132,059,834 (GRCm38) Y408C probably damaging Het
Crocc A G 4: 141,026,099 (GRCm38) probably null Het
Cryzl1 A C 16: 91,712,236 (GRCm38) F59C probably damaging Het
Csmd2 T C 4: 128,496,195 (GRCm38) V2241A probably damaging Het
Cxcl15 C A 5: 90,801,416 (GRCm38) H147N unknown Het
Dnah10 C T 5: 124,760,091 (GRCm38) P966L probably damaging Het
Dpp9 T A 17: 56,194,431 (GRCm38) M594L probably benign Het
Dspp C A 5: 104,175,724 (GRCm38) N244K probably damaging Het
Efcab8 T A 2: 153,814,370 (GRCm38) probably null Het
Fabp3 C T 4: 130,312,387 (GRCm38) T57I probably benign Het
Fbxw17 A G 13: 50,431,657 (GRCm38) M299V probably benign Het
Fbxw7 T A 3: 84,976,352 (GRCm38) I530N probably damaging Het
Gm13023 T C 4: 143,793,546 (GRCm38) V120A possibly damaging Het
Gp2 C A 7: 119,451,585 (GRCm38) D308Y probably null Het
Gpd2 G A 2: 57,357,655 (GRCm38) V537M probably damaging Het
Gpr18 T A 14: 121,911,992 (GRCm38) Y207F probably damaging Het
Grip1 A T 10: 119,897,715 (GRCm38) D20V probably damaging Het
Gzmf A C 14: 56,206,940 (GRCm38) F59V probably damaging Het
Hist1h3a T A 13: 23,761,981 (GRCm38) I125F probably damaging Het
Igfn1 T C 1: 135,955,573 (GRCm38) I2732V probably benign Het
Ipo8 A T 6: 148,782,728 (GRCm38) D855E probably benign Het
Klrk1 A T 6: 129,614,719 (GRCm38) probably null Het
Megf11 A G 9: 64,695,412 (GRCm38) Y876C probably damaging Het
Mettl8 G T 2: 70,982,151 (GRCm38) Q12K probably benign Het
Mrgprf T C 7: 145,308,217 (GRCm38) F172S probably benign Het
Mycbp2 G A 14: 103,224,416 (GRCm38) T1432I probably damaging Het
Nek11 A C 9: 105,348,061 (GRCm38) L84R probably damaging Het
Nlrp1b T C 11: 71,201,273 (GRCm38) E9G probably benign Het
Nrxn1 T C 17: 90,037,187 (GRCm38) I433V probably damaging Het
Nup153 A G 13: 46,693,974 (GRCm38) C660R probably damaging Het
Olfr108 T A 17: 37,446,200 (GRCm38) Y226* probably null Het
Olfr1427 G T 19: 12,098,881 (GRCm38) P253T probably damaging Het
Olfr196 T A 16: 59,167,901 (GRCm38) M81L probably benign Het
Olfr447 T C 6: 42,912,144 (GRCm38) V207A possibly damaging Het
P2rx7 T A 5: 122,670,465 (GRCm38) N303K possibly damaging Het
Pank4 T C 4: 154,970,047 (GRCm38) L159P probably damaging Het
Pcdhb22 A T 18: 37,518,500 (GRCm38) H7L probably benign Het
Pdzd8 A T 19: 59,301,339 (GRCm38) I543N probably benign Het
Prrc2b C A 2: 32,194,461 (GRCm38) R313S probably damaging Het
Rbm12b1 T C 4: 12,145,827 (GRCm38) C600R probably benign Het
Rem1 G A 2: 152,634,535 (GRCm38) V238M probably damaging Het
Rfx6 T A 10: 51,678,402 (GRCm38) M113K possibly damaging Het
Rlf A T 4: 121,149,823 (GRCm38) D653E probably benign Het
Rnf130 A G 11: 50,087,386 (GRCm38) D258G possibly damaging Het
Robo2 A G 16: 73,956,523 (GRCm38) V822A possibly damaging Het
Rps6kc1 G T 1: 190,800,336 (GRCm38) Q490K possibly damaging Het
Scn9a T C 2: 66,483,506 (GRCm38) Y1945C probably damaging Het
Setd2 T A 9: 110,549,857 (GRCm38) D913E probably benign Het
Sfr1 G T 19: 47,735,003 (GRCm38) E315D possibly damaging Het
Smarca5 G A 8: 80,709,220 (GRCm38) R763* probably null Het
Sugct A C 13: 17,672,566 (GRCm38) I44S probably damaging Het
Syce1l A G 8: 113,654,030 (GRCm38) probably null Het
Tbc1d8b A G X: 139,734,080 (GRCm38) I654V probably benign Het
Tcf23 T A 5: 30,973,508 (GRCm38) Y163* probably null Het
Terf2ip TG T 8: 112,011,606 (GRCm38) probably null Het
Tmem158 T C 9: 123,259,885 (GRCm38) S221G possibly damaging Het
Tnrc6a A G 7: 123,169,982 (GRCm38) T332A probably benign Het
Trappc4 T C 9: 44,407,211 (GRCm38) T31A probably benign Het
Trim27 T C 13: 21,188,065 (GRCm38) probably null Het
Ttyh2 T A 11: 114,708,475 (GRCm38) L330Q probably damaging Het
Tubgcp3 A T 8: 12,639,532 (GRCm38) L578* probably null Het
Txndc11 C A 16: 11,128,701 (GRCm38) E83* probably null Het
Utp20 T C 10: 88,749,297 (GRCm38) K2635R probably benign Het
V1ra8 C T 6: 90,203,322 (GRCm38) T169I probably damaging Het
Vcl G A 14: 21,019,373 (GRCm38) V706I probably benign Het
Vmn2r106 A T 17: 20,279,111 (GRCm38) D179E probably benign Het
Vmn2r80 T C 10: 79,194,389 (GRCm38) M683T probably benign Het
Xirp2 A G 2: 67,509,871 (GRCm38) I819V probably benign Het
Zfp735 T C 11: 73,711,763 (GRCm38) F511S probably benign Het
Zfp831 T C 2: 174,645,890 (GRCm38) V786A probably benign Het
Zfp992 T A 4: 146,466,492 (GRCm38) H223Q probably benign Het
Zfyve19 A C 2: 119,210,819 (GRCm38) Q72P probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,911,762 (GRCm38) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,906,884 (GRCm38) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,842,621 (GRCm38) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,842,561 (GRCm38) nonsense probably null
IGL01828:Dennd4a APN 9 64,842,561 (GRCm38) nonsense probably null
IGL01829:Dennd4a APN 9 64,842,561 (GRCm38) nonsense probably null
IGL01979:Dennd4a APN 9 64,894,409 (GRCm38) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,909,706 (GRCm38) splice site probably benign
IGL02339:Dennd4a APN 9 64,842,561 (GRCm38) nonsense probably null
IGL02341:Dennd4a APN 9 64,842,561 (GRCm38) nonsense probably null
IGL02584:Dennd4a APN 9 64,851,298 (GRCm38) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,862,327 (GRCm38) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,910,191 (GRCm38) splice site probably benign
IGL02701:Dennd4a APN 9 64,897,353 (GRCm38) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,862,414 (GRCm38) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,871,874 (GRCm38) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,888,526 (GRCm38) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,888,974 (GRCm38) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,871,882 (GRCm38) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,896,715 (GRCm38) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,896,715 (GRCm38) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,893,294 (GRCm38) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,852,445 (GRCm38) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,862,391 (GRCm38) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,851,383 (GRCm38) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,911,675 (GRCm38) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,910,004 (GRCm38) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,906,045 (GRCm38) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,911,665 (GRCm38) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,871,882 (GRCm38) missense probably benign 0.32
R1824:Dennd4a UTSW 9 64,859,358 (GRCm38) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,862,030 (GRCm38) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,897,234 (GRCm38) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,897,336 (GRCm38) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,889,086 (GRCm38) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,842,490 (GRCm38) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,852,467 (GRCm38) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,852,467 (GRCm38) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,889,605 (GRCm38) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,905,974 (GRCm38) splice site probably null
R2138:Dennd4a UTSW 9 64,889,337 (GRCm38) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,852,417 (GRCm38) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,906,081 (GRCm38) missense probably benign 0.03
R3108:Dennd4a UTSW 9 64,912,387 (GRCm38) missense probably benign 0.23
R3176:Dennd4a UTSW 9 64,888,993 (GRCm38) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,888,993 (GRCm38) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,888,993 (GRCm38) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,888,993 (GRCm38) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,872,028 (GRCm38) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,852,575 (GRCm38) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,862,331 (GRCm38) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,911,892 (GRCm38) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,910,123 (GRCm38) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,910,123 (GRCm38) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,910,123 (GRCm38) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,894,407 (GRCm38) missense probably benign
R4701:Dennd4a UTSW 9 64,897,357 (GRCm38) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,897,249 (GRCm38) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,889,056 (GRCm38) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,896,590 (GRCm38) missense probably benign
R4881:Dennd4a UTSW 9 64,838,844 (GRCm38) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,906,003 (GRCm38) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,888,928 (GRCm38) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,904,227 (GRCm38) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,851,209 (GRCm38) splice site probably null
R5868:Dennd4a UTSW 9 64,896,729 (GRCm38) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,911,755 (GRCm38) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,886,945 (GRCm38) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,871,899 (GRCm38) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,852,420 (GRCm38) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,886,965 (GRCm38) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,852,489 (GRCm38) nonsense probably null
R7056:Dennd4a UTSW 9 64,906,923 (GRCm38) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,894,399 (GRCm38) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,896,474 (GRCm38) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,861,956 (GRCm38) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,897,269 (GRCm38) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,852,570 (GRCm38) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,873,044 (GRCm38) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,888,587 (GRCm38) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,852,431 (GRCm38) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,906,920 (GRCm38) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,872,993 (GRCm38) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,852,512 (GRCm38) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,873,030 (GRCm38) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,888,568 (GRCm38) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,849,175 (GRCm38) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,906,875 (GRCm38) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,889,109 (GRCm38) missense probably benign
R8425:Dennd4a UTSW 9 64,838,974 (GRCm38) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,886,879 (GRCm38) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,912,390 (GRCm38) missense probably benign
R9219:Dennd4a UTSW 9 64,889,094 (GRCm38) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,842,624 (GRCm38) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,912,692 (GRCm38) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,907,106 (GRCm38) nonsense probably null
R9672:Dennd4a UTSW 9 64,893,358 (GRCm38) missense probably benign
R9746:Dennd4a UTSW 9 64,894,511 (GRCm38) missense probably benign
X0026:Dennd4a UTSW 9 64,897,320 (GRCm38) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,872,022 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGTATTGACCCCAATGCAATC -3'
(R):5'- AGGCTTCCAGAACCAGGTACTGTG -3'

Sequencing Primer
(F):5'- TTGACCCCAATGCAATCACTTATG -3'
(R):5'- gagccatctcatcagccc -3'
Posted On 2014-05-14