Incidental Mutation 'R0087:Ap3s1'
ID19985
Institutional Source Beutler Lab
Gene Symbol Ap3s1
Ensembl Gene ENSMUSG00000024480
Gene Nameadaptor-related protein complex 3, sigma 1 subunit
Synonyms[s]3A
MMRRC Submission 038374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0087 (G1)
Quality Score184
Status Validated (trace)
Chromosome18
Chromosomal Location46741876-46790826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46758039 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 66 (R66S)
Ref Sequence ENSEMBL: ENSMUSP00000153510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025357] [ENSMUST00000224622] [ENSMUST00000225415] [ENSMUST00000225520] [ENSMUST00000226108]
Predicted Effect probably damaging
Transcript: ENSMUST00000025357
AA Change: R66S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025357
Gene: ENSMUSG00000024480
AA Change: R66S

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 1.4e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224622
AA Change: R66S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000225415
Predicted Effect probably damaging
Transcript: ENSMUST00000225520
AA Change: R66S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226108
AA Change: R66S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9301 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.5%
  • 20x: 82.3%
Validation Efficiency 86% (59/69)
MGI Phenotype FUNCTION: This gene encodes the sigma subunit of the heterotetrameric adaptor protein complex AP-3 which is involved in the formation of specialized lysosome-related compartments such as melanosomes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on chromosomes 1, 8, 16, 17 and X. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Adgrv1 T A 13: 81,386,951 I5732F probably damaging Het
Adss A T 1: 177,771,222 V330E probably benign Het
Agps T A 2: 75,909,635 Y488N probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp2a2 C T 5: 122,460,961 V593I probably benign Het
Chrna6 C T 8: 27,406,986 V288M probably damaging Het
Col4a2 C T 8: 11,441,296 L1232F probably benign Het
Dcaf1 A G 9: 106,863,089 N1225D probably damaging Het
Degs1 A G 1: 182,279,310 I128T probably benign Het
Dnah5 A T 15: 28,350,613 T2594S probably damaging Het
Dnah8 G T 17: 30,755,119 R2826L probably damaging Het
Elf3 A G 1: 135,257,137 Y104H probably damaging Het
Fam222b C A 11: 78,153,892 T93N probably benign Het
Fbxw26 A G 9: 109,724,938 I211T probably benign Het
Fcho2 T C 13: 98,735,086 T541A probably benign Het
Flg2 T C 3: 93,202,431 S589P unknown Het
Foxj3 T A 4: 119,626,400 V589E unknown Het
Gria1 A G 11: 57,317,712 Y742C probably damaging Het
Inpp5d T C 1: 87,715,138 S672P probably damaging Het
Lrrc19 A C 4: 94,640,772 F91C probably damaging Het
Lrrc6 T C 15: 66,469,975 T91A probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mroh3 T C 1: 136,190,803 I561V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Nbea G T 3: 56,091,023 T121K possibly damaging Het
Nbr1 A C 11: 101,564,693 D91A probably benign Het
Ncam2 C A 16: 81,434,901 N84K probably benign Het
Olfr1260 T C 2: 89,978,131 Y118H probably damaging Het
Olfr616 A T 7: 103,564,362 C306S probably benign Het
Olfr618 A G 7: 103,597,721 Y135C probably benign Het
Olfr651 A G 7: 104,553,662 I248V possibly damaging Het
Olfr711 A G 7: 106,972,116 V76A probably benign Het
Pdgfrb A T 18: 61,061,513 I121F probably damaging Het
Peak1 A T 9: 56,258,325 I773N probably damaging Het
Pfkfb4 G T 9: 109,007,701 V155F probably damaging Het
Pkm C T 9: 59,678,099 R455* probably null Het
Plbd2 C A 5: 120,494,485 E151* probably null Het
Pld5 G A 1: 175,984,459 T353M probably damaging Het
Psme2b A T 11: 48,945,717 D134E possibly damaging Het
Rida T A 15: 34,488,626 D40V possibly damaging Het
Rnf126 A T 10: 79,759,234 H265Q probably damaging Het
Rock2 C A 12: 16,928,966 Q86K probably benign Het
Serpinb1b A T 13: 33,085,319 T12S probably benign Het
Slco6c1 T A 1: 97,118,578 Q277L probably benign Het
Sptlc2 T A 12: 87,369,118 H45L probably benign Het
Srsf4 A G 4: 131,900,330 probably benign Het
Sspo A G 6: 48,477,785 S2969G probably damaging Het
Steap1 C T 5: 5,736,664 G258R probably damaging Het
Stk19 A T 17: 34,836,875 M1K probably null Het
Stk-ps2 C A 1: 46,029,889 noncoding transcript Het
Taf1c C T 8: 119,600,987 R332H probably damaging Het
Thbs4 T A 13: 92,755,235 T791S probably damaging Het
Theg A T 10: 79,585,951 Y144* probably null Het
Tjap1 A G 17: 46,263,726 L21P probably damaging Het
Tmem145 A G 7: 25,307,843 Y148C probably damaging Het
Tmem267 T A 13: 119,609,274 V155E probably benign Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Tyro3 T G 2: 119,801,701 I83S probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r53 A T 6: 90,223,431 C304S probably benign Het
Vwf G A 6: 125,645,954 M1761I probably benign Het
Zfp276 T C 8: 123,265,047 Y445H probably damaging Het
Zfp407 A T 18: 84,560,411 I859N probably damaging Het
Other mutations in Ap3s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0410:Ap3s1 UTSW 18 46779212 missense probably benign 0.02
R2102:Ap3s1 UTSW 18 46754402 missense possibly damaging 0.88
R4234:Ap3s1 UTSW 18 46779200 missense probably benign 0.28
R4500:Ap3s1 UTSW 18 46790000 missense possibly damaging 0.47
R4894:Ap3s1 UTSW 18 46758116 critical splice donor site probably null
R5081:Ap3s1 UTSW 18 46754430 missense probably benign 0.01
R6063:Ap3s1 UTSW 18 46754438 missense probably benign 0.02
R6209:Ap3s1 UTSW 18 46779251 missense probably benign 0.00
R6250:Ap3s1 UTSW 18 46754447 missense probably damaging 1.00
R6401:Ap3s1 UTSW 18 46758007 missense probably benign 0.00
R6575:Ap3s1 UTSW 18 46754381 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGACACCCTCCCCTACCTGTTAA -3'
(R):5'- TCATGATGGCACAGTCTCTCTAAGTGAA -3'

Sequencing Primer
(F):5'- gcctgacacacagtacttactc -3'
(R):5'- tcttctaccaaattctttcttccac -3'
Posted On2013-04-11