Incidental Mutation 'R9413:Ap3s1'
ID 711911
Institutional Source Beutler Lab
Gene Symbol Ap3s1
Ensembl Gene ENSMUSG00000024480
Gene Name adaptor-related protein complex 3, sigma 1 subunit
Synonyms [s]3A
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9413 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 46741876-46790826 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 46754464 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025357] [ENSMUST00000224622] [ENSMUST00000225415] [ENSMUST00000225520] [ENSMUST00000226108]
AlphaFold Q9DCR2
Predicted Effect probably null
Transcript: ENSMUST00000025357
SMART Domains Protein: ENSMUSP00000025357
Gene: ENSMUSG00000024480

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 1.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224622
Predicted Effect probably benign
Transcript: ENSMUST00000225415
Predicted Effect probably benign
Transcript: ENSMUST00000225520
Predicted Effect probably benign
Transcript: ENSMUST00000226108
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes the sigma subunit of the heterotetrameric adaptor protein complex AP-3 which is involved in the formation of specialized lysosome-related compartments such as melanosomes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on chromosomes 1, 8, 16, 17 and X. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,199 T1194S probably benign Het
Akr7a5 A T 4: 139,310,748 probably benign Het
Ap3b2 G T 7: 81,478,009 P140T possibly damaging Het
Arrdc2 C T 8: 70,836,248 R381H probably damaging Het
Atg13 T C 2: 91,681,625 D286G probably benign Het
C1qtnf4 T C 2: 90,890,304 F307S probably damaging Het
Cdk5rap1 A T 2: 154,365,960 probably null Het
Chsy3 C T 18: 59,176,098 A141V possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
D5Ertd579e A G 5: 36,614,934 S706P probably damaging Het
Ell2 A G 13: 75,769,586 D545G Het
Ephb6 T C 6: 41,614,575 L222P Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Gm6619 A T 6: 131,491,407 D167V unknown Het
Gucy2c T C 6: 136,723,773 D581G possibly damaging Het
Hectd1 G A 12: 51,746,097 R2471* probably null Het
Kif1a A T 1: 93,021,297 M1501K probably benign Het
Mycbpap A G 11: 94,501,495 V390A probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pex3 A G 10: 13,534,710 Y236H probably damaging Het
Pglyrp3 G T 3: 92,022,799 A91S probably damaging Het
Ppp1ca T C 19: 4,194,898 S292P probably damaging Het
Prkci T C 3: 31,043,766 V455A probably damaging Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Psd4 C T 2: 24,397,460 T468I probably benign Het
Rnf213 A G 11: 119,466,233 E4203G Het
Snrnp27 T C 6: 86,676,273 D121G possibly damaging Het
Spag6 A T 2: 18,734,218 M320L probably benign Het
Spata16 T A 3: 26,924,337 M484K possibly damaging Het
Trim69 G A 2: 122,178,602 W381* probably null Het
Tubgcp3 A C 8: 12,624,885 I745S probably damaging Het
Ubxn2b A G 4: 6,204,607 D156G probably damaging Het
Vmn2r103 A G 17: 19,811,896 N644S possibly damaging Het
Other mutations in Ap3s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Ap3s1 UTSW 18 46758039 missense probably damaging 1.00
R0410:Ap3s1 UTSW 18 46779212 missense probably benign 0.02
R2102:Ap3s1 UTSW 18 46754402 missense possibly damaging 0.88
R4234:Ap3s1 UTSW 18 46779200 missense probably benign 0.28
R4500:Ap3s1 UTSW 18 46790000 missense possibly damaging 0.47
R4894:Ap3s1 UTSW 18 46758116 critical splice donor site probably null
R5081:Ap3s1 UTSW 18 46754430 missense probably benign 0.01
R6063:Ap3s1 UTSW 18 46754438 missense probably benign 0.02
R6209:Ap3s1 UTSW 18 46779251 missense probably benign 0.00
R6250:Ap3s1 UTSW 18 46754447 missense probably damaging 1.00
R6401:Ap3s1 UTSW 18 46758007 missense probably benign 0.00
R6575:Ap3s1 UTSW 18 46754381 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTCGGCCAGAATTTTCCAG -3'
(R):5'- GCAACATGCAAATGAACATTAAGTG -3'

Sequencing Primer
(F):5'- TCCTTCCTCAGAGTGAAG -3'
(R):5'- GCAAATGAACATTAAGTGTGATCTC -3'
Posted On 2022-05-16