Incidental Mutation 'R1816:4933434E20Rik'
ID204403
Institutional Source Beutler Lab
Gene Symbol 4933434E20Rik
Ensembl Gene ENSMUSG00000027942
Gene NameRIKEN cDNA 4933434E20 gene
Synonyms
MMRRC Submission 039844-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1816 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90051636-90068347 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90053091 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 13 (V13A)
Ref Sequence ENSEMBL: ENSMUSP00000123740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029552] [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000068798] [ENSMUST00000090908] [ENSMUST00000159064] [ENSMUST00000160640] [ENSMUST00000161918] [ENSMUST00000162114] [ENSMUST00000195995] [ENSMUST00000196633] [ENSMUST00000196843] [ENSMUST00000196917] [ENSMUST00000197903] [ENSMUST00000198322] [ENSMUST00000199834] [ENSMUST00000199929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029552
AA Change: V13A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029552
Gene: ENSMUSG00000027942
AA Change: V13A

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068798
AA Change: V13A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066840
Gene: ENSMUSG00000027942
AA Change: V13A

DomainStartEndE-ValueType
Pfam:NICE-3 1 171 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090908
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159064
AA Change: V13A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124554
Gene: ENSMUSG00000027942
AA Change: V13A

DomainStartEndE-ValueType
Pfam:NICE-3 6 188 4.2e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159202
SMART Domains Protein: ENSMUSP00000123777
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 61 2.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160263
Predicted Effect possibly damaging
Transcript: ENSMUST00000160640
AA Change: V13A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124028
Gene: ENSMUSG00000027942
AA Change: V13A

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 3.2e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161874
Predicted Effect possibly damaging
Transcript: ENSMUST00000161918
AA Change: V13A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123740
Gene: ENSMUSG00000027942
AA Change: V13A

DomainStartEndE-ValueType
Pfam:NICE-3 1 64 2.2e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162114
AA Change: V13A

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124822
Gene: ENSMUSG00000027942
AA Change: V13A

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162595
Predicted Effect probably benign
Transcript: ENSMUST00000195995
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect probably benign
Transcript: ENSMUST00000196633
SMART Domains Protein: ENSMUSP00000143423
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 6.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196917
SMART Domains Protein: ENSMUSP00000142602
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 50 2e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000197903
SMART Domains Protein: ENSMUSP00000143519
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 81 7e-32 PDB
Blast:UBA 50 81 7e-16 BLAST
SCOP:d1efub3 51 81 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198282
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199834
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199929
SMART Domains Protein: ENSMUSP00000142488
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 57 2e-12 PDB
Meta Mutation Damage Score 0.4046 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.9%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T A 7: 40,994,798 Y721* probably null Het
4933405L10Rik T A 8: 105,709,859 V220E possibly damaging Het
Adam1b T G 5: 121,501,725 Q419P probably damaging Het
Ankib1 A G 5: 3,734,028 V316A probably benign Het
Anks1 T A 17: 27,986,573 D294E probably damaging Het
Atr T C 9: 95,866,694 S431P probably benign Het
BC005561 A G 5: 104,517,834 D74G probably benign Het
BC037034 A G 5: 138,260,341 V548A possibly damaging Het
Bfsp1 C T 2: 143,841,679 A242T probably benign Het
Bptf A T 11: 107,060,579 V279E probably damaging Het
Camkk2 A G 5: 122,734,180 L540P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Ceacam12 T A 7: 18,071,765 probably null Het
Cntnap5a G T 1: 116,428,888 A823S probably benign Het
Cp T C 3: 19,968,220 probably benign Het
Dhx58 A G 11: 100,703,152 V163A probably damaging Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Disp1 T A 1: 183,098,575 D288V probably damaging Het
Dnah7a A G 1: 53,631,742 probably benign Het
Eaf2 T G 16: 36,808,009 probably benign Het
Efna1 T C 3: 89,276,387 N44S possibly damaging Het
Etnppl T C 3: 130,634,562 I462T probably benign Het
Fam83d G T 2: 158,768,150 A13S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Fstl1 A G 16: 37,826,724 probably null Het
Gm14226 A T 2: 155,025,629 D502V probably damaging Het
Gm5117 T A 8: 31,738,958 noncoding transcript Het
Gm973 A G 1: 59,582,399 N566S probably damaging Het
Grm7 A T 6: 111,495,791 K16* probably null Het
Hbb-bh2 G A 7: 103,840,378 T17I possibly damaging Het
Htt C T 5: 34,803,740 A237V probably benign Het
Itga6 T C 2: 71,840,809 V665A probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Mki67 T C 7: 135,707,387 D445G possibly damaging Het
Myo10 T C 15: 25,800,200 V1454A probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Odam A G 5: 87,889,470 probably null Het
Olfr1080 A T 2: 86,553,667 C152* probably null Het
Olfr1179 T G 2: 88,402,599 I112L possibly damaging Het
Olfr393 T C 11: 73,847,199 K309E probably benign Het
Olfr508 T C 7: 108,630,157 L55P probably damaging Het
Olfr695 A T 7: 106,873,488 Y252* probably null Het
Olfr998 G T 2: 85,590,925 K128N probably benign Het
Pcm1 T A 8: 41,309,537 S1412T probably damaging Het
Pgap1 A G 1: 54,492,057 L753P probably damaging Het
Pi4k2b T C 5: 52,750,746 S153P probably damaging Het
Pik3c2b C T 1: 133,101,370 A1398V probably benign Het
Pkhd1l1 T C 15: 44,528,239 I1567T possibly damaging Het
Rapgef6 G A 11: 54,694,488 V1571I probably benign Het
Rfx2 C A 17: 56,808,305 E5* probably null Het
Sh3tc1 C A 5: 35,700,584 probably null Het
Slc22a12 G A 19: 6,542,653 Q20* probably null Het
Slc4a1 A G 11: 102,351,230 C861R probably damaging Het
Snrnp25 G A 11: 32,207,565 V48I probably damaging Het
Spata1 G T 3: 146,481,207 P211Q probably damaging Het
Srgap1 G A 10: 121,925,971 Q91* probably null Het
Stab1 T C 14: 31,157,465 D686G probably benign Het
Stx8 T A 11: 68,011,326 M112K possibly damaging Het
Tfap2b A T 1: 19,209,212 K15N probably damaging Het
Thbs2 C A 17: 14,670,713 D1052Y probably benign Het
Thbs2 T A 17: 14,670,714 E1051D probably benign Het
Tlr2 T C 3: 83,838,209 Y189C probably damaging Het
Tmem268 C A 4: 63,565,710 P55T possibly damaging Het
Tnpo3 T C 6: 29,557,017 H745R probably benign Het
Ube2s T C 7: 4,811,555 N2S probably damaging Het
Ulk1 A G 5: 110,787,831 Y39H probably damaging Het
Vmn1r49 G T 6: 90,072,803 D72E possibly damaging Het
Vmn2r27 C A 6: 124,230,371 G104* probably null Het
Vmn2r92 A G 17: 18,166,677 I93V probably damaging Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zfp958 A T 8: 4,629,147 I391F possibly damaging Het
Other mutations in 4933434E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:4933434E20Rik APN 3 90053093 missense possibly damaging 0.65
IGL01621:4933434E20Rik APN 3 90064502 missense possibly damaging 0.82
IGL01984:4933434E20Rik APN 3 90063230 missense probably benign 0.00
IGL02005:4933434E20Rik APN 3 90058620 missense probably damaging 1.00
R0446:4933434E20Rik UTSW 3 90064459 missense probably benign 0.00
R1717:4933434E20Rik UTSW 3 90056237 missense probably benign 0.23
R2170:4933434E20Rik UTSW 3 90056304 missense probably benign 0.07
R2299:4933434E20Rik UTSW 3 90064538 missense possibly damaging 0.88
R2981:4933434E20Rik UTSW 3 90058631 missense probably benign 0.00
R3879:4933434E20Rik UTSW 3 90063254 unclassified probably benign
R4065:4933434E20Rik UTSW 3 90058766 nonsense probably null
R4724:4933434E20Rik UTSW 3 90053541 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053542 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053583 missense probably damaging 0.99
R4835:4933434E20Rik UTSW 3 90063209 missense probably benign 0.22
R5076:4933434E20Rik UTSW 3 90056252 missense probably benign 0.01
R6126:4933434E20Rik UTSW 3 90056574 missense probably damaging 0.98
R6337:4933434E20Rik UTSW 3 90061733 missense probably benign 0.03
R6562:4933434E20Rik UTSW 3 90063236 missense probably benign 0.38
R7312:4933434E20Rik UTSW 3 90061714 missense probably benign 0.07
R7316:4933434E20Rik UTSW 3 90061713 missense probably benign
R7473:4933434E20Rik UTSW 3 90058653 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACCATGTTTTCTGACGGACTC -3'
(R):5'- ACTGTCTACGGATACAATTCGG -3'

Sequencing Primer
(F):5'- TTCTGACGGACTCTAGCCTGG -3'
(R):5'- GTCTACGGATACAATTCGGAAGTCC -3'
Posted On2014-06-23