Incidental Mutation 'R1901:Olfr685'
ID212212
Institutional Source Beutler Lab
Gene Symbol Olfr685
Ensembl Gene ENSMUSG00000047794
Gene Nameolfactory receptor 685
SynonymsGA_x6K02T2PBJ9-7810071-7809121, MOR37-1
MMRRC Submission 039921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1901 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105178416-105186012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105180872 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 162 (I162T)
Ref Sequence ENSEMBL: ENSMUSP00000148994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051355] [ENSMUST00000209409] [ENSMUST00000214712] [ENSMUST00000217432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051355
AA Change: I147T

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061561
Gene: ENSMUSG00000047794
AA Change: I147T

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 3e-107 PFAM
Pfam:7TM_GPCR_Srsx 38 217 2.9e-8 PFAM
Pfam:7tm_1 44 295 7e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209409
AA Change: I162T

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214712
AA Change: I162T

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217432
AA Change: I162T

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,346,099 E466G probably damaging Het
Acacb A T 5: 114,165,734 R73* probably null Het
Acta1 A T 8: 123,893,161 S147T probably benign Het
Adh1 G A 3: 138,288,797 V293I probably benign Het
Aldh3b3 T C 19: 3,965,130 Y170H probably damaging Het
Ank3 A T 10: 69,822,337 T198S probably damaging Het
Ankrd12 A T 17: 65,986,703 N578K possibly damaging Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Col19a1 A T 1: 24,536,997 I88K unknown Het
Col1a1 G A 11: 94,946,632 probably null Het
Col5a1 A G 2: 27,960,444 T518A unknown Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Dlec1 T C 9: 119,102,644 S44P probably damaging Het
Dock9 T C 14: 121,625,153 probably null Het
Flrt2 C A 12: 95,779,130 P81T probably damaging Het
Flrt2 C T 12: 95,779,131 P81L probably damaging Het
Ginm1 A G 10: 7,775,216 probably null Het
Glis3 T C 19: 28,531,585 N333S probably damaging Het
Glo1 T G 17: 30,596,408 E144D probably benign Het
Golga1 A T 2: 39,047,780 probably null Het
H2-Aa A G 17: 34,283,233 I155T possibly damaging Het
Haus5 A G 7: 30,657,245 S479P probably damaging Het
Il10ra A T 9: 45,256,356 V299D probably benign Het
Il17re T C 6: 113,469,704 V472A probably damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Inppl1 T C 7: 101,823,377 E1237G possibly damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl35 T C 7: 99,470,220 L304P probably damaging Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Lrrc29 T C 8: 105,313,075 N556S probably damaging Het
Med15 G T 16: 17,673,154 probably benign Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Mroh1 A G 15: 76,436,049 T1008A probably benign Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Mug2 C A 6: 122,071,842 H856N probably benign Het
Naca T A 10: 128,043,721 probably benign Het
Nagk G T 6: 83,799,354 V184F probably damaging Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncor2 T A 5: 125,025,425 H2089L probably benign Het
Nek6 A G 2: 38,582,446 I261V probably damaging Het
Neurod2 G A 11: 98,327,732 T202M probably damaging Het
Nlgn2 A G 11: 69,825,900 V605A probably damaging Het
Nlrp5 A C 7: 23,423,910 E732A possibly damaging Het
Nt5dc1 A T 10: 34,313,671 V340D probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr417 A T 1: 174,369,168 I84L probably benign Het
Olfr625-ps1 T C 7: 103,683,543 I265T probably damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pcdhb12 T A 18: 37,437,630 W610R possibly damaging Het
Pias2 T A 18: 77,097,443 C66* probably null Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Prpf8 T G 11: 75,504,744 V1899G probably damaging Het
Prr13 C A 15: 102,460,698 probably benign Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
R3hdm2 T C 10: 127,498,468 I947T possibly damaging Het
Raet1d A G 10: 22,371,451 D142G probably damaging Het
Rbbp8nl C T 2: 180,283,313 R33Q probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Rptn A T 3: 93,396,710 H450L possibly damaging Het
Scn11a T A 9: 119,779,036 K1010* probably null Het
Slc16a10 G A 10: 40,056,606 Q33* probably null Het
Slc31a1 C T 4: 62,385,605 probably benign Het
Slc34a1 A T 13: 55,401,150 K138* probably null Het
Slc6a18 T A 13: 73,670,043 E285V probably benign Het
Slco6c1 T A 1: 97,072,982 T515S probably damaging Het
Snrnp40 T A 4: 130,385,975 S295T probably damaging Het
Snx4 A T 16: 33,284,438 Y252F possibly damaging Het
Spata18 T A 5: 73,671,139 F348I probably damaging Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tcp10b A G 17: 13,081,626 K399E possibly damaging Het
Tcstv3 A G 13: 120,317,724 H53R probably damaging Het
Tnrc6c A G 11: 117,723,005 K823R probably damaging Het
Trim31 A G 17: 36,901,800 E221G probably benign Het
Trim47 T A 11: 116,107,779 Q338L probably damaging Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Usp9y A G Y: 1,303,371 probably null Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vldlr T C 19: 27,241,309 V147A probably damaging Het
Vmn1r115 C T 7: 20,844,273 R238H probably benign Het
Vmn1r175 C A 7: 23,808,793 R136S probably benign Het
Vmn1r53 A G 6: 90,224,286 S19P possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp362 G T 4: 128,790,276 P13T probably damaging Het
Zfp825 A G 13: 74,480,945 C151R probably damaging Het
Other mutations in Olfr685
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Olfr685 APN 7 105180488 missense probably benign 0.00
IGL01612:Olfr685 APN 7 105180722 missense probably damaging 1.00
IGL02598:Olfr685 APN 7 105180956 missense probably damaging 1.00
R0841:Olfr685 UTSW 7 105180854 missense probably damaging 0.96
R1164:Olfr685 UTSW 7 105180833 missense probably benign 0.02
R1711:Olfr685 UTSW 7 105180760 missense probably damaging 0.99
R1891:Olfr685 UTSW 7 105180547 nonsense probably null
R1990:Olfr685 UTSW 7 105181014 missense probably damaging 1.00
R3766:Olfr685 UTSW 7 105180881 missense probably damaging 0.98
R4750:Olfr685 UTSW 7 105180926 missense probably damaging 1.00
R5056:Olfr685 UTSW 7 105180572 missense probably damaging 1.00
R5061:Olfr685 UTSW 7 105180657 missense possibly damaging 0.56
R6227:Olfr685 UTSW 7 105180710 missense probably damaging 1.00
R7619:Olfr685 UTSW 7 105180749 missense probably damaging 1.00
R8075:Olfr685 UTSW 7 105181136 missense probably damaging 0.98
R8250:Olfr685 UTSW 7 105181311 missense
Predicted Primers PCR Primer
(F):5'- CAGACCATAAGCTCGATTCACTG -3'
(R):5'- TGCTATTGACCTGGTCCTGG -3'

Sequencing Primer
(F):5'- CACTGTGGTTTCAGAACAGGC -3'
(R):5'- AAAGCCCTCACTGTGCTC -3'
Posted On2014-06-30