Incidental Mutation 'R7820:Tmem2'
ID601842
Institutional Source Beutler Lab
Gene Symbol Tmem2
Ensembl Gene ENSMUSG00000024754
Gene Nametransmembrane protein 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location21778342-21858327 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21807461 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 436 (A436V)
Ref Sequence ENSEMBL: ENSMUSP00000093908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025663] [ENSMUST00000096194]
Predicted Effect probably damaging
Transcript: ENSMUST00000025663
AA Change: A436V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025663
Gene: ENSMUSG00000024754
AA Change: A436V

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Pfam:ILEI 265 360 2.1e-24 PFAM
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Pfam:ILEI 1243 1333 9e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000096194
AA Change: A436V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093908
Gene: ENSMUSG00000024754
AA Change: A436V

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
G8 121 245 1.89e-44 SMART
Blast:PbH1 587 609 1e-6 BLAST
low complexity region 621 633 N/A INTRINSIC
PbH1 669 691 3.62e3 SMART
PbH1 711 733 1.84e3 SMART
PbH1 791 812 1.33e3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Tmem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Tmem2 APN 19 21844757 missense possibly damaging 0.77
IGL01528:Tmem2 APN 19 21835545 missense possibly damaging 0.95
IGL01642:Tmem2 APN 19 21823901 missense probably damaging 1.00
IGL01693:Tmem2 APN 19 21801887 missense probably benign 0.00
IGL02437:Tmem2 APN 19 21811978 critical splice donor site probably null
IGL02869:Tmem2 APN 19 21811877 missense probably damaging 0.99
IGL02880:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02904:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02941:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL02950:Tmem2 APN 19 21842200 missense probably benign 0.07
IGL03066:Tmem2 APN 19 21823843 missense possibly damaging 0.68
IGL03120:Tmem2 APN 19 21823843 missense possibly damaging 0.68
R0005:Tmem2 UTSW 19 21812220 missense probably damaging 0.98
R0496:Tmem2 UTSW 19 21797345 missense possibly damaging 0.89
R0557:Tmem2 UTSW 19 21811903 missense probably benign 0.05
R0620:Tmem2 UTSW 19 21817971 missense probably benign
R1271:Tmem2 UTSW 19 21823904 missense possibly damaging 0.92
R1435:Tmem2 UTSW 19 21844706 missense probably benign
R1543:Tmem2 UTSW 19 21812573 missense probably benign 0.03
R1558:Tmem2 UTSW 19 21797982 nonsense probably null
R1658:Tmem2 UTSW 19 21801879 missense probably damaging 1.00
R1744:Tmem2 UTSW 19 21832137 nonsense probably null
R1859:Tmem2 UTSW 19 21847977 missense possibly damaging 0.56
R1943:Tmem2 UTSW 19 21848040 splice site probably null
R2001:Tmem2 UTSW 19 21801987 missense probably benign 0.43
R2021:Tmem2 UTSW 19 21844750 missense possibly damaging 0.91
R2177:Tmem2 UTSW 19 21811785 missense possibly damaging 0.80
R2183:Tmem2 UTSW 19 21823793 missense possibly damaging 0.81
R2921:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2922:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R2923:Tmem2 UTSW 19 21817939 missense possibly damaging 0.80
R3727:Tmem2 UTSW 19 21844711 missense probably benign
R3730:Tmem2 UTSW 19 21826117 missense probably damaging 0.97
R3790:Tmem2 UTSW 19 21807452 missense probably damaging 1.00
R3831:Tmem2 UTSW 19 21847951 missense probably damaging 0.97
R3858:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3859:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R3899:Tmem2 UTSW 19 21852234 missense probably benign 0.01
R4096:Tmem2 UTSW 19 21792652 start codon destroyed probably null 0.99
R4206:Tmem2 UTSW 19 21842115 missense probably damaging 1.00
R4480:Tmem2 UTSW 19 21815489 missense probably benign 0.03
R4667:Tmem2 UTSW 19 21797351 missense probably benign 0.00
R4667:Tmem2 UTSW 19 21844781 missense probably benign
R4888:Tmem2 UTSW 19 21856164 missense probably benign 0.00
R4914:Tmem2 UTSW 19 21809289 missense probably benign 0.00
R5030:Tmem2 UTSW 19 21842105 missense probably benign
R5329:Tmem2 UTSW 19 21798329 missense probably benign 0.30
R5977:Tmem2 UTSW 19 21826083 missense probably benign 0.01
R6013:Tmem2 UTSW 19 21832039 missense possibly damaging 0.89
R6049:Tmem2 UTSW 19 21826126 missense probably benign
R6199:Tmem2 UTSW 19 21844822 missense probably benign 0.05
R6215:Tmem2 UTSW 19 21812387 missense probably benign 0.02
R6273:Tmem2 UTSW 19 21802005 missense probably damaging 1.00
R6429:Tmem2 UTSW 19 21801908 missense probably benign 0.14
R6547:Tmem2 UTSW 19 21844831 missense probably benign 0.01
R6630:Tmem2 UTSW 19 21852229 missense probably damaging 0.99
R6870:Tmem2 UTSW 19 21832123 missense possibly damaging 0.91
R7276:Tmem2 UTSW 19 21835460 missense probably benign 0.14
R7336:Tmem2 UTSW 19 21826145 nonsense probably null
R7363:Tmem2 UTSW 19 21856211 missense probably benign
R7678:Tmem2 UTSW 19 21798116 missense probably damaging 1.00
R7727:Tmem2 UTSW 19 21829957 missense probably benign 0.00
R7837:Tmem2 UTSW 19 21798021 missense probably benign 0.40
R7859:Tmem2 UTSW 19 21832175 missense possibly damaging 0.95
R8058:Tmem2 UTSW 19 21852331 missense probably benign 0.12
R8251:Tmem2 UTSW 19 21807401 missense possibly damaging 0.82
Z1177:Tmem2 UTSW 19 21855729 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTAATGTGCACGTATAGTTG -3'
(R):5'- CACCCCTGGAATCTAGCGATTG -3'

Sequencing Primer
(F):5'- TTGATGTACGGAAACCCTCG -3'
(R):5'- GTAGTATCCACACTGACACGGG -3'
Posted On2019-12-03