Incidental Mutation 'R1976:Slc22a17'
ID221763
Institutional Source Beutler Lab
Gene Symbol Slc22a17
Ensembl Gene ENSMUSG00000022199
Gene Namesolute carrier family 22 (organic cation transporter), member 17
Synonyms1700094C23Rik
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54906304-54913132 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 54908500 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050772] [ENSMUST00000227880] [ENSMUST00000228119] [ENSMUST00000228495] [ENSMUST00000228588] [ENSMUST00000231305]
Predicted Effect probably null
Transcript: ENSMUST00000050772
SMART Domains Protein: ENSMUSP00000049676
Gene: ENSMUSG00000022199

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 370 1.8e-17 PFAM
Pfam:MFS_1 211 394 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226456
Predicted Effect probably benign
Transcript: ENSMUST00000226467
Predicted Effect probably benign
Transcript: ENSMUST00000226690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227600
Predicted Effect probably benign
Transcript: ENSMUST00000227880
Predicted Effect probably null
Transcript: ENSMUST00000228119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228249
Predicted Effect probably null
Transcript: ENSMUST00000228495
Predicted Effect probably benign
Transcript: ENSMUST00000228588
Predicted Effect probably null
Transcript: ENSMUST00000231305
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Naalad2 T C 9: 18,378,699 E211G probably damaging Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Slc22a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Slc22a17 APN 14 54907261 missense probably damaging 1.00
IGL02216:Slc22a17 APN 14 54907976 makesense probably null
IGL02588:Slc22a17 APN 14 54907994 missense probably damaging 1.00
R1576:Slc22a17 UTSW 14 54907990 missense probably damaging 1.00
R2027:Slc22a17 UTSW 14 54908086 missense probably damaging 1.00
R2165:Slc22a17 UTSW 14 54908825 nonsense probably null
R3547:Slc22a17 UTSW 14 54907237 missense probably damaging 1.00
R5175:Slc22a17 UTSW 14 54907291 missense probably damaging 1.00
R5609:Slc22a17 UTSW 14 54908970 missense probably damaging 1.00
R7456:Slc22a17 UTSW 14 54912259 missense probably benign 0.05
R7538:Slc22a17 UTSW 14 54912118 missense probably benign 0.00
R8068:Slc22a17 UTSW 14 54908908 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGTGAAGCCCAGGATAAGC -3'
(R):5'- AGGGCTTTACAGTTGACCCTAC -3'

Sequencing Primer
(F):5'- GCCCAGGATAAGCAGATTTTTCCAG -3'
(R):5'- AGTTGACCCTACCACCCTG -3'
Posted On2014-08-25