Incidental Mutation 'R1976:Naalad2'
ID221721
Institutional Source Beutler Lab
Gene Symbol Naalad2
Ensembl Gene ENSMUSG00000043943
Gene NameN-acetylated alpha-linked acidic dipeptidase 2
SynonymsNAADALASE2, GCP3, NAALADASE2, Folh1b, GCPIII, D9Ertd285e
MMRRC Submission 039989-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R1976 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location18321951-18402995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18378699 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 211 (E211G)
Ref Sequence ENSEMBL: ENSMUSP00000130752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001826] [ENSMUST00000166825] [ENSMUST00000172171]
Predicted Effect probably damaging
Transcript: ENSMUST00000001826
AA Change: E211G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001826
Gene: ENSMUSG00000043943
AA Change: E211G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 198 290 2.2e-14 PFAM
Pfam:Peptidase_M28 385 593 9.4e-22 PFAM
Pfam:TFR_dimer 655 775 1.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166825
AA Change: E173G

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128674
Gene: ENSMUSG00000043943
AA Change: E173G

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PA 155 253 2.8e-14 PFAM
Pfam:Peptidase_M28 360 554 8.2e-18 PFAM
Pfam:TFR_dimer 616 739 3.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168934
Predicted Effect probably damaging
Transcript: ENSMUST00000172171
AA Change: E211G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130752
Gene: ENSMUSG00000043943
AA Change: E211G

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
Pfam:PA 193 291 3.5e-14 PFAM
Pfam:Peptidase_M28 398 592 1.2e-17 PFAM
Pfam:TFR_dimer 654 777 6.4e-42 PFAM
Meta Mutation Damage Score 0.2738 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-acetylated alpha-linked acidic dipeptidase (NAALADase) gene family. The representative member of this family is the gene encoding human prostate-specific membrane antigen (PSM), which is a marker of prostatic carcinomas and is the first to be shown to possess NAALADase activity. NAALADase cleaves N-acetyl-L-aspartate-L-glutamate (NAAG), which is a neuropeptide expressed both in the central nervous systems and in the periphery and is thought to function as a neurotransmitter. The product of this gene is a type II integral membrane protein. Transient transfection of this gene confers both NAALADase and dipetidyl peptidase IV activities to mammalian cells. This gene is highly expressed in ovary and testis as well as within discrete brain areas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A C 7: 34,257,380 N353K probably damaging Het
Abca13 T C 11: 9,397,815 V3556A probably damaging Het
Abcb5 T C 12: 118,890,682 I833V probably benign Het
Adgrd1 A T 5: 129,140,797 H432L probably benign Het
Alppl2 T A 1: 87,088,741 I204F probably damaging Het
Ascc3 T A 10: 50,649,166 F486I probably damaging Het
Bcl9l T A 9: 44,506,152 L429Q possibly damaging Het
Ccdc33 A T 9: 58,117,162 Y227* probably null Het
Cd101 A G 3: 101,008,061 V730A probably damaging Het
Cdadc1 A T 14: 59,573,768 V431E probably damaging Het
Dazap1 T A 10: 80,274,620 probably null Het
Dbpht2 T A 12: 74,295,861 noncoding transcript Het
Dennd4b A T 3: 90,273,055 T742S probably damaging Het
Dhtkd1 T C 2: 5,902,391 E838G possibly damaging Het
Dync2h1 A T 9: 7,129,045 D1823E probably benign Het
Enox1 T A 14: 77,668,793 N556K probably benign Het
Fam227a T C 15: 79,626,276 I392M possibly damaging Het
Fnip2 A T 3: 79,480,931 M831K probably benign Het
Foxn1 T C 11: 78,365,937 probably benign Het
Glis3 T C 19: 28,262,677 probably benign Het
Gm4953 T A 1: 159,168,353 noncoding transcript Het
Gsr T G 8: 33,680,260 probably null Het
Habp4 G T 13: 64,184,606 V344F probably benign Het
Hdac7 G A 15: 97,806,505 Q495* probably null Het
Helb T C 10: 120,094,263 D737G possibly damaging Het
Hltf A G 3: 20,106,446 D759G probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itsn2 A G 12: 4,672,733 probably benign Het
Kank2 A T 9: 21,794,561 V387E probably damaging Het
Lefty1 T C 1: 180,937,824 V319A probably benign Het
Lonp1 T C 17: 56,615,068 T771A possibly damaging Het
Lpcat2b A T 5: 107,433,850 K348N possibly damaging Het
Lsamp T C 16: 41,889,067 V103A probably damaging Het
Ltbp4 A T 7: 27,326,770 C538S probably damaging Het
Micu1 T C 10: 59,768,213 S174P probably damaging Het
Mta1 A G 12: 113,136,306 N607S probably damaging Het
Muc5b C T 7: 141,863,154 S3279L probably benign Het
Nup155 T A 15: 8,135,827 M649K probably benign Het
Pan2 T C 10: 128,320,413 V1171A probably damaging Het
Pisd A G 5: 32,738,865 V372A probably damaging Het
Prim1 T A 10: 128,023,799 C288S probably benign Het
Rab23 T A 1: 33,723,938 C30S probably damaging Het
Sacs A G 14: 61,202,895 T797A probably benign Het
Sall3 T C 18: 80,971,893 D940G probably benign Het
Scn1a T C 2: 66,331,271 E311G probably benign Het
Sdk1 T A 5: 142,143,818 I1598N probably damaging Het
Slc22a17 A T 14: 54,908,500 probably null Het
Slc36a4 T A 9: 15,734,210 V311D probably damaging Het
Sprr3 T A 3: 92,456,946 Q197L possibly damaging Het
Stab2 A C 10: 86,896,496 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tas2r123 T A 6: 132,847,332 V64D probably damaging Het
Trhde T G 10: 114,588,431 N483T possibly damaging Het
Trp53 C T 11: 69,588,497 T167M probably damaging Het
Tspan8 A G 10: 115,844,130 I217V probably benign Het
Usp17la A G 7: 104,860,320 E44G possibly damaging Het
Usp40 T G 1: 87,978,536 Q659P probably benign Het
Vmn1r4 T C 6: 56,956,738 C76R probably damaging Het
Vmn2r118 C T 17: 55,592,925 G660R probably damaging Het
Zcchc11 T C 4: 108,479,523 L148P probably benign Het
Zfp786 T A 6: 47,819,757 H749L probably damaging Het
Other mutations in Naalad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Naalad2 APN 9 18327373 missense probably damaging 0.97
IGL02160:Naalad2 APN 9 18379937 missense probably damaging 1.00
IGL03246:Naalad2 APN 9 18385099 missense possibly damaging 0.92
IGL03351:Naalad2 APN 9 18364187 missense possibly damaging 0.57
ithaca UTSW 9 18378699 missense probably damaging 1.00
odysseus UTSW 9 18376533 missense possibly damaging 0.63
R0112:Naalad2 UTSW 9 18351447 nonsense probably null
R0266:Naalad2 UTSW 9 18350943 splice site probably benign
R0505:Naalad2 UTSW 9 18385895 missense probably benign
R1077:Naalad2 UTSW 9 18347506 missense probably damaging 1.00
R1442:Naalad2 UTSW 9 18351032 splice site probably benign
R1553:Naalad2 UTSW 9 18378669 missense probably benign 0.01
R1694:Naalad2 UTSW 9 18327387 missense probably damaging 0.96
R1912:Naalad2 UTSW 9 18376535 missense probably benign 0.00
R2224:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2225:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2227:Naalad2 UTSW 9 18376533 missense possibly damaging 0.63
R2287:Naalad2 UTSW 9 18335021 splice site probably null
R4126:Naalad2 UTSW 9 18347470 missense probably damaging 1.00
R4784:Naalad2 UTSW 9 18350918 missense probably damaging 1.00
R5426:Naalad2 UTSW 9 18347519 missense probably benign 0.11
R5470:Naalad2 UTSW 9 18330851 missense probably damaging 1.00
R5644:Naalad2 UTSW 9 18334931 missense possibly damaging 0.90
R5888:Naalad2 UTSW 9 18330641 missense probably benign 0.34
R6194:Naalad2 UTSW 9 18351147 missense probably benign 0.23
R6238:Naalad2 UTSW 9 18385065 missense probably damaging 1.00
R6701:Naalad2 UTSW 9 18385148 missense probably null 0.05
R6764:Naalad2 UTSW 9 18402889 start gained probably benign
R6791:Naalad2 UTSW 9 18385130 missense possibly damaging 0.67
R7133:Naalad2 UTSW 9 18327377 missense probably benign 0.00
R7137:Naalad2 UTSW 9 18323487 missense probably benign 0.00
R7212:Naalad2 UTSW 9 18364041 intron probably null
R7588:Naalad2 UTSW 9 18351479 missense probably damaging 0.99
Z1177:Naalad2 UTSW 9 18351102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGTCTTCTGTGTACCCAGG -3'
(R):5'- AAAGTGTGTGCATCTAGATGGG -3'

Sequencing Primer
(F):5'- TCTTCTGTGTACCCAGGGAGAAC -3'
(R):5'- TGCATCTAGATGGGAGGGG -3'
Posted On2014-08-25