Mutagenetix > Incidental Mutation

Incidental Mutation 'R1976:Mta1'

221757

Institutional Source

Beutler Lab

Gene Symbol

Mta1

Ensembl Gene

ENSMUSG00000021144

Gene Name

metastasis associated 1

Synonyms

MMRRC Submission

039989-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1976 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113098278-113137206 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113136306 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 607 (N607S)

Ref Sequence

ENSEMBL: ENSMUSP00000105348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]

AlphaFold

Q8K4B0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009099
AA Change: N624S

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: N624S

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	695	705	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069690
AA Change: N607S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: N607S

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084882

SMART Domains

Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

Domain	Start	End	E-Value	Type
LIM	4	56	2.08e-12	SMART
low complexity region	104	115	N/A	INTRINSIC
LIM	125	177	6.05e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109723
AA Change: N612S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: N612S

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109726
AA Change: N607S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: N607S

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109727
AA Change: N612S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: N612S

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156030

Predicted Effect

probably benign
Transcript: ENSMUST00000200380

SMART Domains

Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

Domain	Start	End	E-Value	Type
LIM	1	53	3e-16	SMART

Meta Mutation Damage Score

0.0936

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.8%

Validation Efficiency

98% (65/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	C	7: 34,257,380	N353K	probably damaging	Het
Abca13	T	C	11: 9,397,815	V3556A	probably damaging	Het
Abcb5	T	C	12: 118,890,682	I833V	probably benign	Het
Adgrd1	A	T	5: 129,140,797	H432L	probably benign	Het
Alppl2	T	A	1: 87,088,741	I204F	probably damaging	Het
Ascc3	T	A	10: 50,649,166	F486I	probably damaging	Het
Bcl9l	T	A	9: 44,506,152	L429Q	possibly damaging	Het
Ccdc33	A	T	9: 58,117,162	Y227*	probably null	Het
Cd101	A	G	3: 101,008,061	V730A	probably damaging	Het
Cdadc1	A	T	14: 59,573,768	V431E	probably damaging	Het
Dazap1	T	A	10: 80,274,620		probably null	Het
Dbpht2	T	A	12: 74,295,861		noncoding transcript	Het
Dennd4b	A	T	3: 90,273,055	T742S	probably damaging	Het
Dhtkd1	T	C	2: 5,902,391	E838G	possibly damaging	Het
Dync2h1	A	T	9: 7,129,045	D1823E	probably benign	Het
Enox1	T	A	14: 77,668,793	N556K	probably benign	Het
Fam227a	T	C	15: 79,626,276	I392M	possibly damaging	Het
Fnip2	A	T	3: 79,480,931	M831K	probably benign	Het
Foxn1	T	C	11: 78,365,937		probably benign	Het
Glis3	T	C	19: 28,262,677	936	probably benign	Het
Gm4953	T	A	1: 159,168,353		noncoding transcript	Het
Gsr	T	G	8: 33,680,260		probably null	Het
Habp4	G	T	13: 64,184,606	V344F	probably benign	Het
Hdac7	G	A	15: 97,806,505	Q495*	probably null	Het
Helb	T	C	10: 120,094,263	D737G	possibly damaging	Het
Hltf	A	G	3: 20,106,446	D759G	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itsn2	A	G	12: 4,672,733		probably benign	Het
Kank2	A	T	9: 21,794,561	V387E	probably damaging	Het
Lefty1	T	C	1: 180,937,824	V319A	probably benign	Het
Lonp1	T	C	17: 56,615,068	T771A	possibly damaging	Het
Lpcat2b	A	T	5: 107,433,850	K348N	possibly damaging	Het
Lsamp	T	C	16: 41,889,067	V103A	probably damaging	Het
Ltbp4	A	T	7: 27,326,770	C538S	probably damaging	Het
Micu1	T	C	10: 59,768,213	S174P	probably damaging	Het
Muc5b	C	T	7: 141,863,154	S3279L	probably benign	Het
Naalad2	T	C	9: 18,378,699	E211G	probably damaging	Het
Nup155	T	A	15: 8,135,827	M649K	probably benign	Het
Pan2	T	C	10: 128,320,413	V1171A	probably damaging	Het
Pisd	A	G	5: 32,738,865	V372A	probably damaging	Het
Prim1	T	A	10: 128,023,799	C288S	probably benign	Het
Rab23	T	A	1: 33,723,938	C30S	probably damaging	Het
Sacs	A	G	14: 61,202,895	T797A	probably benign	Het
Sall3	T	C	18: 80,971,893	D940G	probably benign	Het
Scn1a	T	C	2: 66,331,271	E311G	probably benign	Het
Sdk1	T	A	5: 142,143,818	I1598N	probably damaging	Het
Slc22a17	A	T	14: 54,908,500		probably null	Het
Slc36a4	T	A	9: 15,734,210	V311D	probably damaging	Het
Sprr3	T	A	3: 92,456,946	Q197L	possibly damaging	Het
Stab2	A	C	10: 86,896,496		probably null	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Tas2r123	T	A	6: 132,847,332	V64D	probably damaging	Het
Trhde	T	G	10: 114,588,431	N483T	possibly damaging	Het
Trp53	C	T	11: 69,588,497	T167M	probably damaging	Het
Tspan8	A	G	10: 115,844,130	I217V	probably benign	Het
Usp17la	A	G	7: 104,860,320	E44G	possibly damaging	Het
Usp40	T	G	1: 87,978,536	Q659P	probably benign	Het
Vmn1r4	T	C	6: 56,956,738	C76R	probably damaging	Het
Vmn2r118	C	T	17: 55,592,925	G660R	probably damaging	Het
Zcchc11	T	C	4: 108,479,523	L148P	probably benign	Het
Zfp786	T	A	6: 47,819,757	H749L	probably damaging	Het

Other mutations in Mta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02227:Mta1	APN	12	113120908	missense	possibly damaging	0.94
IGL02250:Mta1	APN	12	113126798	missense	possibly damaging	0.59
IGL02391:Mta1	APN	12	113136583	missense	possibly damaging	0.79
IGL02670:Mta1	APN	12	113130121	missense	probably damaging	1.00
PIT4382001:Mta1	UTSW	12	113133250	missense	probably benign	0.06
R0361:Mta1	UTSW	12	113133341	splice site	probably null
R0496:Mta1	UTSW	12	113131321	nonsense	probably null
R1774:Mta1	UTSW	12	113128039	missense	probably damaging	1.00
R1870:Mta1	UTSW	12	113128074	missense	possibly damaging	0.73
R2110:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2111:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2184:Mta1	UTSW	12	113130195	critical splice donor site	probably null
R2274:Mta1	UTSW	12	113128150	missense	probably damaging	1.00
R4087:Mta1	UTSW	12	113112182	missense	probably damaging	1.00
R4231:Mta1	UTSW	12	113135827	missense	possibly damaging	0.95
R4916:Mta1	UTSW	12	113136540	missense	probably benign	0.17
R5032:Mta1	UTSW	12	113133525	splice site	probably null
R5271:Mta1	UTSW	12	113131957	missense	probably damaging	0.99
R5344:Mta1	UTSW	12	113131566	splice site	probably benign
R5392:Mta1	UTSW	12	113133236	missense	probably benign
R5656:Mta1	UTSW	12	113123139	missense	probably damaging	1.00
R5903:Mta1	UTSW	12	113136619	missense	probably damaging	1.00
R6168:Mta1	UTSW	12	113123119	missense	probably damaging	0.96
R7091:Mta1	UTSW	12	113136402	missense	probably damaging	1.00
R7334:Mta1	UTSW	12	113126798	missense	possibly damaging	0.59
R7408:Mta1	UTSW	12	113131468	critical splice donor site	probably null
R7889:Mta1	UTSW	12	113131688	missense	probably benign	0.02
R8136:Mta1	UTSW	12	113131678	missense	probably damaging	1.00
R8176:Mta1	UTSW	12	113120836	missense	probably benign	0.00
R8385:Mta1	UTSW	12	113131465	missense	probably benign
R8398:Mta1	UTSW	12	113131622	missense	possibly damaging	0.83
R9132:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9159:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9418:Mta1	UTSW	12	113131367	missense	probably damaging	1.00
R9489:Mta1	UTSW	12	113131465	missense	probably benign
R9596:Mta1	UTSW	12	113126850	missense	probably damaging	0.99
R9682:Mta1	UTSW	12	113131764	critical splice donor site	probably null
Z1088:Mta1	UTSW	12	113133200	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GCATTCAGGTCTCTACAGCC -3'
(R):5'- TCCTGTGGGAAGAGGTAAGC -3'

Sequencing Primer
(F):5'- AGGTCTCTACAGCCCTCCAG -3'
(R):5'- GAGGGTGGTAGCTGAAGACTCTC -3'

Posted On

2014-08-25