Incidental Mutation 'R2125:Loxl1'
ID229772
Institutional Source Beutler Lab
Gene Symbol Loxl1
Ensembl Gene ENSMUSG00000032334
Gene Namelysyl oxidase-like 1
SynonymsLOXL
MMRRC Submission 040128-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2125 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58287738-58313186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58293712 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 489 (D489G)
Ref Sequence ENSEMBL: ENSMUSP00000057406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061799]
Predicted Effect probably damaging
Transcript: ENSMUST00000061799
AA Change: D489G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057406
Gene: ENSMUSG00000032334
AA Change: D489G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 82 96 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
Pfam:Lysyl_oxidase 403 604 5.1e-98 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the lysyl oxidase family of copper-dependent enzymes that catalyze the formation of lysine-derived crosslinks in proteins such as collagen and elastin. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional enzyme. Mice lacking the encoded protein fail to deposit normal elastic fibers in the uterine tract post partum and develop pelvic organ prolapse, enlarged airspaces of the lung, loose skin and vascular abnormalities with concomitant tropoelastin accumulation. [provided by RefSeq, Sep 2016]
PHENOTYPE: Elastic fiber homeostasis is disrupted in homozygous mutant mice, resulting in loose skin, abnormal lung morphology, intestinal defects, and post partum uterine prolapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,158,022 Y2265F probably benign Het
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Abcb10 A C 8: 123,965,092 V378G probably benign Het
Ackr2 C T 9: 121,908,786 R76* probably null Het
Acly T C 11: 100,523,496 T35A probably benign Het
Acp7 A C 7: 28,629,549 F69V probably damaging Het
Acsl3 T A 1: 78,681,961 I110N probably damaging Het
Adam5 C T 8: 24,815,118 V107M probably damaging Het
Adck2 T C 6: 39,575,142 V281A probably benign Het
Adgrv1 A G 13: 81,419,535 V5173A probably benign Het
Adgrv1 A T 13: 81,419,950 S5035T probably benign Het
AI314180 T C 4: 58,833,978 H834R probably benign Het
Arl10 T A 13: 54,579,124 probably null Het
B3gnt3 A G 8: 71,693,358 W176R probably damaging Het
B4galt4 T C 16: 38,765,938 I3T probably damaging Het
Casr T C 16: 36,495,252 I819V possibly damaging Het
Cdh1 T C 8: 106,656,840 V237A probably damaging Het
Col22a1 G A 15: 71,848,577 R605C unknown Het
Crlf3 A G 11: 80,059,255 V183A probably benign Het
Crtac1 C A 19: 42,323,732 V181L probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnhd1 A T 7: 105,677,971 H709L probably benign Het
Dopey1 A G 9: 86,521,046 Y1431C probably damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Entpd3 T C 9: 120,555,654 I99T probably damaging Het
Epha6 T C 16: 59,682,688 D952G probably damaging Het
Exoc6 T C 19: 37,590,941 L429P probably damaging Het
F13a1 A G 13: 36,892,841 S625P probably benign Het
Fcho2 T C 13: 98,775,898 N240S possibly damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Fmo6 A T 1: 162,929,958 M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 I479R probably damaging Het
Gm14409 C A 2: 177,265,402 C101F probably damaging Het
Gnl2 T A 4: 125,053,485 F633L probably benign Het
Greb1l C T 18: 10,511,422 S648F probably damaging Het
Gsap T A 5: 21,242,813 C290S probably damaging Het
Gusb A G 5: 129,999,447 V268A probably benign Het
H2-D1 G A 17: 35,264,115 probably null Het
Hebp2 T A 10: 18,541,260 E164D probably benign Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hoxc13 G T 15: 102,927,223 R262L probably damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Impg2 T A 16: 56,265,064 Y1045N probably damaging Het
Kcnk1 A G 8: 125,995,656 E66G probably damaging Het
Klkb1 A G 8: 45,275,504 V406A possibly damaging Het
Klra10 G A 6: 130,279,278 R138W probably damaging Het
Lama2 A C 10: 27,044,453 Y193* probably null Het
Larp7 T C 3: 127,543,130 T428A probably benign Het
Lipg T C 18: 74,945,885 N432S probably benign Het
Lrguk A G 6: 34,092,902 K571E probably benign Het
Map3k13 C T 16: 21,892,144 T59I probably benign Het
Mertk T A 2: 128,762,138 D397E probably benign Het
Mgat3 G A 15: 80,211,886 V305I probably benign Het
Mkl2 T C 16: 13,400,804 V449A possibly damaging Het
Mybpc1 G A 10: 88,573,437 Q66* probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Ndufaf3 C T 9: 108,566,737 R31Q probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrxn3 A G 12: 89,260,520 probably null Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1257 A G 2: 89,881,638 M271V probably benign Het
Pcsk4 T C 10: 80,323,879 M379V probably benign Het
Pdzd2 A T 15: 12,373,590 V2153E probably benign Het
Pkd2l1 T C 19: 44,154,500 D427G possibly damaging Het
Plcd4 A G 1: 74,565,152 Y763C probably damaging Het
Plekhh1 T C 12: 79,079,000 F1270S probably damaging Het
Pmfbp1 T C 8: 109,520,273 V259A probably damaging Het
Ptprg T C 14: 12,179,283 S767P possibly damaging Het
Rabl3 T G 16: 37,556,813 probably null Het
Rffl T A 11: 82,818,438 H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Scaf11 A T 15: 96,419,315 D789E possibly damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Siglech T A 7: 55,771,686 F190I probably benign Het
Slc22a22 C A 15: 57,254,240 A302S probably damaging Het
Slc46a3 T A 5: 147,879,144 T458S probably benign Het
Spta1 G T 1: 174,208,344 R1072L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tfip11 T C 5: 112,335,663 V648A possibly damaging Het
Thumpd3 T C 6: 113,066,788 V388A probably benign Het
Tmem131l C T 3: 83,942,751 probably null Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttn A T 2: 76,890,092 probably null Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vtn A G 11: 78,500,223 T210A probably damaging Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Other mutations in Loxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Loxl1 APN 9 58294422 missense possibly damaging 0.89
IGL02549:Loxl1 APN 9 58293638 missense probably damaging 1.00
IGL02562:Loxl1 APN 9 58288916 missense probably damaging 1.00
IGL03062:Loxl1 APN 9 58311910 missense possibly damaging 0.61
R0141:Loxl1 UTSW 9 58312132 missense probably damaging 0.98
R1503:Loxl1 UTSW 9 58293640 missense probably damaging 1.00
R1898:Loxl1 UTSW 9 58297678 missense probably damaging 1.00
R2264:Loxl1 UTSW 9 58297678 missense probably damaging 1.00
R4094:Loxl1 UTSW 9 58312456 missense probably damaging 0.98
R4993:Loxl1 UTSW 9 58312537 missense probably damaging 0.99
R5484:Loxl1 UTSW 9 58290782 missense possibly damaging 0.75
R5598:Loxl1 UTSW 9 58312367 missense possibly damaging 0.71
R5808:Loxl1 UTSW 9 58294449 missense probably damaging 0.99
R5917:Loxl1 UTSW 9 58312723 missense probably damaging 1.00
R7566:Loxl1 UTSW 9 58312198 missense probably damaging 0.98
R7899:Loxl1 UTSW 9 58290834 missense probably damaging 1.00
R7982:Loxl1 UTSW 9 58290834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCATAGACGCCTGCATC -3'
(R):5'- TTTTGCCCAAGAGAGACCAG -3'

Sequencing Primer
(F):5'- TGCATCCACCCAGCCACATTAG -3'
(R):5'- GGAGCCTTAGGAGGTGCCATTC -3'
Posted On2014-09-17