Incidental Mutation 'R2125:Abcb10'
ID229769
Institutional Source Beutler Lab
Gene Symbol Abcb10
Ensembl Gene ENSMUSG00000031974
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 10
SynonymsABC-me
MMRRC Submission 040128-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2125 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123952459-123983122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 123965092 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 378 (V378G)
Ref Sequence ENSEMBL: ENSMUSP00000075011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075578] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000075578
AA Change: V378G

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075011
Gene: ENSMUSG00000031974
AA Change: V378G

DomainStartEndE-ValueType
Pfam:ABC_membrane 136 407 1.7e-60 PFAM
AAA 484 675 1.68e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ATP-binding cassette superfamily of transporters. ATP-binding cassette proteins transport various molecules across extra- and intra-cellular membranes. The encoded protein is localized to the mitochondrial inner membrane where it interacts with and stabilizes mitoferrin-1, and is important for heme biosynthesis. Additional evidence suggests the encoded protein is involved in oxidative stress protection and erythropoisesis. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased response to ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,158,022 Y2265F probably benign Het
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Ackr2 C T 9: 121,908,786 R76* probably null Het
Acly T C 11: 100,523,496 T35A probably benign Het
Acp7 A C 7: 28,629,549 F69V probably damaging Het
Acsl3 T A 1: 78,681,961 I110N probably damaging Het
Adam5 C T 8: 24,815,118 V107M probably damaging Het
Adck2 T C 6: 39,575,142 V281A probably benign Het
Adgrv1 A G 13: 81,419,535 V5173A probably benign Het
Adgrv1 A T 13: 81,419,950 S5035T probably benign Het
AI314180 T C 4: 58,833,978 H834R probably benign Het
Arl10 T A 13: 54,579,124 probably null Het
B3gnt3 A G 8: 71,693,358 W176R probably damaging Het
B4galt4 T C 16: 38,765,938 I3T probably damaging Het
Casr T C 16: 36,495,252 I819V possibly damaging Het
Cdh1 T C 8: 106,656,840 V237A probably damaging Het
Col22a1 G A 15: 71,848,577 R605C unknown Het
Crlf3 A G 11: 80,059,255 V183A probably benign Het
Crtac1 C A 19: 42,323,732 V181L probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnhd1 A T 7: 105,677,971 H709L probably benign Het
Dopey1 A G 9: 86,521,046 Y1431C probably damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Entpd3 T C 9: 120,555,654 I99T probably damaging Het
Epha6 T C 16: 59,682,688 D952G probably damaging Het
Exoc6 T C 19: 37,590,941 L429P probably damaging Het
F13a1 A G 13: 36,892,841 S625P probably benign Het
Fcho2 T C 13: 98,775,898 N240S possibly damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Fmo6 A T 1: 162,929,958 M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 I479R probably damaging Het
Gm14409 C A 2: 177,265,402 C101F probably damaging Het
Gnl2 T A 4: 125,053,485 F633L probably benign Het
Greb1l C T 18: 10,511,422 S648F probably damaging Het
Gsap T A 5: 21,242,813 C290S probably damaging Het
Gusb A G 5: 129,999,447 V268A probably benign Het
H2-D1 G A 17: 35,264,115 probably null Het
Hebp2 T A 10: 18,541,260 E164D probably benign Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hoxc13 G T 15: 102,927,223 R262L probably damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Impg2 T A 16: 56,265,064 Y1045N probably damaging Het
Kcnk1 A G 8: 125,995,656 E66G probably damaging Het
Klkb1 A G 8: 45,275,504 V406A possibly damaging Het
Klra10 G A 6: 130,279,278 R138W probably damaging Het
Lama2 A C 10: 27,044,453 Y193* probably null Het
Larp7 T C 3: 127,543,130 T428A probably benign Het
Lipg T C 18: 74,945,885 N432S probably benign Het
Loxl1 T C 9: 58,293,712 D489G probably damaging Het
Lrguk A G 6: 34,092,902 K571E probably benign Het
Map3k13 C T 16: 21,892,144 T59I probably benign Het
Mertk T A 2: 128,762,138 D397E probably benign Het
Mgat3 G A 15: 80,211,886 V305I probably benign Het
Mkl2 T C 16: 13,400,804 V449A possibly damaging Het
Mybpc1 G A 10: 88,573,437 Q66* probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Ndufaf3 C T 9: 108,566,737 R31Q probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrxn3 A G 12: 89,260,520 probably null Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1257 A G 2: 89,881,638 M271V probably benign Het
Pcsk4 T C 10: 80,323,879 M379V probably benign Het
Pdzd2 A T 15: 12,373,590 V2153E probably benign Het
Pkd2l1 T C 19: 44,154,500 D427G possibly damaging Het
Plcd4 A G 1: 74,565,152 Y763C probably damaging Het
Plekhh1 T C 12: 79,079,000 F1270S probably damaging Het
Pmfbp1 T C 8: 109,520,273 V259A probably damaging Het
Ptprg T C 14: 12,179,283 S767P possibly damaging Het
Rabl3 T G 16: 37,556,813 probably null Het
Rffl T A 11: 82,818,438 H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Scaf11 A T 15: 96,419,315 D789E possibly damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Siglech T A 7: 55,771,686 F190I probably benign Het
Slc22a22 C A 15: 57,254,240 A302S probably damaging Het
Slc46a3 T A 5: 147,879,144 T458S probably benign Het
Spta1 G T 1: 174,208,344 R1072L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tfip11 T C 5: 112,335,663 V648A possibly damaging Het
Thumpd3 T C 6: 113,066,788 V388A probably benign Het
Tmem131l C T 3: 83,942,751 probably null Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttn A T 2: 76,890,092 probably null Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vtn A G 11: 78,500,223 T210A probably damaging Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Other mutations in Abcb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Abcb10 APN 8 123954427 missense probably benign 0.00
IGL02279:Abcb10 APN 8 123954361 missense probably benign 0.17
IGL02302:Abcb10 APN 8 123958672 missense possibly damaging 0.89
IGL02342:Abcb10 APN 8 123962034 missense probably damaging 1.00
IGL03062:Abcb10 APN 8 123954315 missense possibly damaging 0.49
IGL03409:Abcb10 APN 8 123965023 missense possibly damaging 0.63
R0320:Abcb10 UTSW 8 123963007 missense probably benign 0.00
R0436:Abcb10 UTSW 8 123971001 missense probably benign 0.01
R1074:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1224:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1225:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1226:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1251:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1252:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1254:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1255:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1256:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1355:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1370:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1424:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1499:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R1769:Abcb10 UTSW 8 123962052 missense probably damaging 1.00
R2096:Abcb10 UTSW 8 123982456 missense probably benign 0.01
R2274:Abcb10 UTSW 8 123982752 missense probably benign 0.23
R4801:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4802:Abcb10 UTSW 8 123966527 missense probably benign 0.12
R4850:Abcb10 UTSW 8 123982690 missense probably benign 0.01
R5320:Abcb10 UTSW 8 123971024 missense probably benign 0.11
R5947:Abcb10 UTSW 8 123967998 splice site probably null
R6006:Abcb10 UTSW 8 123968065 missense probably benign 0.00
R6328:Abcb10 UTSW 8 123962017 missense probably damaging 1.00
R7168:Abcb10 UTSW 8 123966611 missense
R8130:Abcb10 UTSW 8 123965018 missense
R8131:Abcb10 UTSW 8 123965018 missense
R8132:Abcb10 UTSW 8 123965018 missense
R8431:Abcb10 UTSW 8 123968134 missense
V7581:Abcb10 UTSW 8 123969761 intron probably benign
Z1176:Abcb10 UTSW 8 123982663 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCACGGTAAGAATGCCCATTC -3'
(R):5'- ATGCAAGTGTTCCCTTCATGG -3'

Sequencing Primer
(F):5'- CCATTCAGTGGGGCCTG -3'
(R):5'- AGAGCAGTCAGTGTTCTCAACCG -3'
Posted On2014-09-17