Incidental Mutation 'R2117:Slc22a7'
ID 231134
Institutional Source Beutler Lab
Gene Symbol Slc22a7
Ensembl Gene ENSMUSG00000067144
Gene Name solute carrier family 22 (organic anion transporter), member 7
Synonyms OAT2, NLT
MMRRC Submission 040121-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R2117 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 46743109-46749383 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 46744898 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 383 (V383L)
Ref Sequence ENSEMBL: ENSMUSP00000084234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024764] [ENSMUST00000087012] [ENSMUST00000113465] [ENSMUST00000165993]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024764
SMART Domains Protein: ENSMUSP00000024764
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087012
AA Change: V383L

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144
AA Change: V383L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113465
SMART Domains Protein: ENSMUSP00000109092
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169441
Predicted Effect probably benign
Transcript: ENSMUST00000165993
SMART Domains Protein: ENSMUSP00000130072
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,640,656 (GRCm39) C3357S probably benign Het
Ago1 T A 4: 126,357,650 (GRCm39) probably null Het
Akap10 A T 11: 61,781,129 (GRCm39) D562E possibly damaging Het
Akr1b7 G A 6: 34,395,929 (GRCm39) A144T possibly damaging Het
Ankle1 A G 8: 71,860,562 (GRCm39) T340A probably benign Het
Arf5 C T 6: 28,424,783 (GRCm39) Q71* probably null Het
Arl15 C T 13: 114,104,196 (GRCm39) S111F probably damaging Het
Asph G A 4: 9,517,671 (GRCm39) Q468* probably null Het
Bcam G T 7: 19,492,352 (GRCm39) A581E possibly damaging Het
Blvra G T 2: 126,927,989 (GRCm39) E80* probably null Het
Ccr6 T C 17: 8,474,914 (GRCm39) F40L possibly damaging Het
Cfap161 A T 7: 83,425,184 (GRCm39) N302K possibly damaging Het
Ckmt2 T A 13: 92,003,964 (GRCm39) I345F probably benign Het
Cpsf6 A G 10: 117,202,025 (GRCm39) probably benign Het
Ctnna1 A G 18: 35,285,678 (GRCm39) N8S possibly damaging Het
Cyp2d11 A G 15: 82,275,954 (GRCm39) L209P probably damaging Het
Dab2 T C 15: 6,465,096 (GRCm39) V628A probably damaging Het
Dcstamp C T 15: 39,618,571 (GRCm39) Q327* probably null Het
Defb38 A T 8: 19,073,483 (GRCm39) Y63* probably null Het
Dlg5 A T 14: 24,227,826 (GRCm39) L365* probably null Het
Dnai7 C T 6: 145,150,967 (GRCm39) probably null Het
Dnmt3l C A 10: 77,899,130 (GRCm39) L110I probably damaging Het
Exoc3l2 G T 7: 19,228,907 (GRCm39) L108F possibly damaging Het
Exoc4 T A 6: 33,324,760 (GRCm39) N351K possibly damaging Het
Fam83h C A 15: 75,876,582 (GRCm39) E252* probably null Het
Fancm A G 12: 65,123,948 (GRCm39) D202G probably damaging Het
Fat1 T A 8: 45,490,500 (GRCm39) V3804E probably benign Het
Fbxw28 T C 9: 109,159,985 (GRCm39) T190A probably benign Het
Fer1l4 T C 2: 155,881,038 (GRCm39) T843A probably benign Het
Fnip1 A T 11: 54,391,450 (GRCm39) H461L probably damaging Het
Gcn1 A T 5: 115,736,884 (GRCm39) M1276L probably benign Het
Gemin4 A G 11: 76,101,827 (GRCm39) V978A possibly damaging Het
Gm7247 A T 14: 51,602,792 (GRCm39) I43F probably damaging Het
Gm9978 C T 10: 78,322,731 (GRCm39) noncoding transcript Het
Gpr4 T C 7: 18,957,070 (GRCm39) S331P probably damaging Het
Hspa1a T A 17: 35,189,455 (GRCm39) N483Y probably damaging Het
Ift74 A G 4: 94,515,496 (GRCm39) T138A probably benign Het
Ints14 T G 9: 64,887,077 (GRCm39) L336R probably damaging Het
Irak1 G T X: 73,066,218 (GRCm39) P197Q possibly damaging Het
Kif4 A G X: 99,709,323 (GRCm39) S315G probably benign Het
L3mbtl1 T A 2: 162,801,990 (GRCm39) probably null Het
Lamb3 A G 1: 193,016,489 (GRCm39) R657G probably benign Het
Ldc1 C A 4: 130,109,156 (GRCm39) V295L possibly damaging Het
Lrp2 A C 2: 69,313,729 (GRCm39) V2334G probably benign Het
Lrwd1 T A 5: 136,159,332 (GRCm39) Y431F probably damaging Het
Map3k21 A T 8: 126,650,781 (GRCm39) H261L probably benign Het
Meis1 G T 11: 18,831,679 (GRCm39) P453Q probably damaging Het
Mettl16 G T 11: 74,693,755 (GRCm39) M255I probably benign Het
Mllt10 A G 2: 18,167,380 (GRCm39) N435S probably benign Het
Mta2 T C 19: 8,920,880 (GRCm39) I27T probably damaging Het
Nav2 A G 7: 49,114,328 (GRCm39) I771V probably benign Het
Nisch A T 14: 30,899,242 (GRCm39) probably benign Het
Npc1 G A 18: 12,329,613 (GRCm39) P990L probably damaging Het
Nrxn1 A T 17: 91,011,705 (GRCm39) I308K probably damaging Het
Or13l2 C A 3: 97,317,765 (GRCm39) C244F probably damaging Het
Or1ad6 A T 11: 50,860,147 (GRCm39) I101F probably damaging Het
Or5h17 T C 16: 58,820,783 (GRCm39) L245P possibly damaging Het
Otogl T C 10: 107,694,779 (GRCm39) D823G probably benign Het
P2rx7 A G 5: 122,819,329 (GRCm39) T584A probably benign Het
Pals1 T C 12: 78,856,696 (GRCm39) F180L possibly damaging Het
Pank1 T A 19: 34,818,486 (GRCm39) I18F probably damaging Het
Pgap3 A G 11: 98,281,933 (GRCm39) L126P probably damaging Het
Pgap6 C T 17: 26,336,858 (GRCm39) L259F possibly damaging Het
Phka1 C T X: 101,653,807 (GRCm39) R290H probably damaging Het
Pkd2 G A 5: 104,631,042 (GRCm39) E489K probably damaging Het
Prdm16 T A 4: 154,432,382 (GRCm39) S296C probably null Het
Prex2 T A 1: 11,256,937 (GRCm39) N1216K probably damaging Het
Prmt7 A G 8: 106,953,930 (GRCm39) T124A probably damaging Het
Ptpra G T 2: 130,381,655 (GRCm39) R372L probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rap2b G T 3: 61,272,512 (GRCm39) G12V probably damaging Het
Rapgef5 T A 12: 117,677,799 (GRCm39) probably null Het
Rassf4 A G 6: 116,622,088 (GRCm39) F168S possibly damaging Het
Rtf1 T A 2: 119,535,999 (GRCm39) H184Q probably benign Het
Sacs A G 14: 61,451,220 (GRCm39) K4422R probably benign Het
Sec11c A T 18: 65,933,720 (GRCm39) T9S probably benign Het
Sema3d C T 5: 12,613,240 (GRCm39) T439I probably benign Het
Sephs1 A G 2: 4,904,351 (GRCm39) N243S probably benign Het
Setd2 TTGGGA T 9: 110,433,212 (GRCm39) probably null Het
Setx A G 2: 29,020,313 (GRCm39) D100G probably benign Het
Slc25a40 T C 5: 8,480,417 (GRCm39) C56R probably damaging Het
Stk38l T A 6: 146,670,344 (GRCm39) L229I probably damaging Het
Sult2a5 T C 7: 13,359,359 (GRCm39) S112P probably damaging Het
Syt4 A G 18: 31,573,520 (GRCm39) Y332H probably damaging Het
Tcof1 T C 18: 60,965,857 (GRCm39) E415G possibly damaging Het
Tenm2 A G 11: 35,915,681 (GRCm39) L1951P probably damaging Het
Tlr9 A G 9: 106,102,536 (GRCm39) N609S probably damaging Het
Tmem120a A T 5: 135,764,977 (GRCm39) S266T possibly damaging Het
Tmem132b A G 5: 125,699,615 (GRCm39) E92G probably damaging Het
Tnfrsf18 T A 4: 156,112,973 (GRCm39) V196E probably damaging Het
Trpc1 A T 9: 95,599,637 (GRCm39) L474H probably damaging Het
Trpm6 T C 19: 18,807,316 (GRCm39) V1020A probably damaging Het
Usp20 T A 2: 30,906,317 (GRCm39) C562S probably damaging Het
Usp47 T A 7: 111,666,443 (GRCm39) probably null Het
Vgll1 A C X: 56,137,790 (GRCm39) K53T probably damaging Het
Vmn1r26 T C 6: 57,985,335 (GRCm39) N285D possibly damaging Het
Zfp445 T A 9: 122,682,502 (GRCm39) K480* probably null Het
Zfp786 A G 6: 47,803,931 (GRCm39) V37A probably damaging Het
Zfp821 A G 8: 110,447,851 (GRCm39) E64G probably damaging Het
Zfp994 T A 17: 22,419,962 (GRCm39) D329V probably damaging Het
Zkscan8 T C 13: 21,704,488 (GRCm39) S484G probably damaging Het
Other mutations in Slc22a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Slc22a7 APN 17 46,748,920 (GRCm39) splice site probably null
R0755:Slc22a7 UTSW 17 46,749,113 (GRCm39) missense possibly damaging 0.93
R0898:Slc22a7 UTSW 17 46,744,075 (GRCm39) missense probably damaging 1.00
R1594:Slc22a7 UTSW 17 46,748,957 (GRCm39) missense possibly damaging 0.94
R1794:Slc22a7 UTSW 17 46,744,079 (GRCm39) missense probably damaging 1.00
R1900:Slc22a7 UTSW 17 46,749,157 (GRCm39) missense probably benign 0.00
R1973:Slc22a7 UTSW 17 46,748,016 (GRCm39) missense probably damaging 1.00
R4467:Slc22a7 UTSW 17 46,743,436 (GRCm39) missense probably benign
R4739:Slc22a7 UTSW 17 46,745,923 (GRCm39) missense probably damaging 1.00
R4921:Slc22a7 UTSW 17 46,747,859 (GRCm39) missense probably benign 0.00
R6982:Slc22a7 UTSW 17 46,745,563 (GRCm39) missense probably benign 0.02
R7122:Slc22a7 UTSW 17 46,749,224 (GRCm39) missense probably damaging 1.00
R7412:Slc22a7 UTSW 17 46,745,553 (GRCm39) missense probably benign 0.00
R7634:Slc22a7 UTSW 17 46,749,156 (GRCm39) missense probably benign 0.02
R8112:Slc22a7 UTSW 17 46,747,756 (GRCm39) missense probably benign 0.00
R8703:Slc22a7 UTSW 17 46,744,951 (GRCm39) missense probably damaging 0.98
R9117:Slc22a7 UTSW 17 46,748,029 (GRCm39) missense probably damaging 1.00
R9541:Slc22a7 UTSW 17 46,749,084 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCCTCAGTGAAGGGATGACC -3'
(R):5'- TCCTAGGCTGCAGTCTCTAAAG -3'

Sequencing Primer
(F):5'- AGCCCCCTAGATGTGAGAC -3'
(R):5'- CTGCAGTCTCTAAAGAGCCAAGTG -3'
Posted On 2014-09-18