Incidental Mutation 'R2198:Celf6'
ID238499
Institutional Source Beutler Lab
Gene Symbol Celf6
Ensembl Gene ENSMUSG00000032297
Gene NameCUGBP, Elav-like family member 6
Synonyms6330569O16Rik, Brunol6
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59577917-59607292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59603339 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 169 (L169F)
Ref Sequence ENSEMBL: ENSMUSP00000112403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034840] [ENSMUST00000118164] [ENSMUST00000118549] [ENSMUST00000121266] [ENSMUST00000129357] [ENSMUST00000143916]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034840
AA Change: L284F

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034840
Gene: ENSMUSG00000032297
AA Change: L284F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
RRM 135 210 1.05e-17 SMART
low complexity region 252 294 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
RRM 376 449 7.35e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118164
AA Change: L169F

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112403
Gene: ENSMUSG00000032297
AA Change: L169F

DomainStartEndE-ValueType
RRM 20 95 1.05e-17 SMART
low complexity region 137 179 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
RRM 260 333 7.35e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000118549
AA Change: L284F

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112755
Gene: ENSMUSG00000032297
AA Change: L284F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
RRM 135 210 1.05e-17 SMART
low complexity region 252 294 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
low complexity region 356 375 N/A INTRINSIC
RRM 397 470 7.35e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121266
AA Change: L169F

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113196
Gene: ENSMUSG00000032297
AA Change: L169F

DomainStartEndE-ValueType
RRM 20 95 1.05e-17 SMART
low complexity region 137 179 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
RRM 261 334 7.35e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129357
SMART Domains Protein: ENSMUSP00000122167
Gene: ENSMUSG00000032297

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 121 1e-14 SMART
low complexity region 138 149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129728
Predicted Effect probably benign
Transcript: ENSMUST00000143916
SMART Domains Protein: ENSMUSP00000118556
Gene: ENSMUSG00000032297

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
Pfam:RRM_1 136 177 1.5e-7 PFAM
Pfam:RRM_6 136 177 3.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146503
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ultrasonic vocalization, decreased brain serotonin levels, and selective behavioral deficits including an abnormal response to novel odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Celf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Celf6 APN 9 59603525 missense probably damaging 0.98
IGL03172:Celf6 APN 9 59582282 missense probably damaging 1.00
R0119:Celf6 UTSW 9 59602878 missense probably benign 0.00
R0299:Celf6 UTSW 9 59602878 missense probably benign 0.00
R0499:Celf6 UTSW 9 59602878 missense probably benign 0.00
R1188:Celf6 UTSW 9 59590678 missense probably benign 0.34
R1543:Celf6 UTSW 9 59603877 splice site probably benign
R2207:Celf6 UTSW 9 59604327 missense possibly damaging 0.93
R4460:Celf6 UTSW 9 59603044 missense probably damaging 1.00
R6908:Celf6 UTSW 9 59603823 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGTTAAGCTGGCAGACAC -3'
(R):5'- AATCCATTGACTCCCATGGGC -3'

Sequencing Primer
(F):5'- TGGCGCCTATACCACTGC -3'
(R):5'- TCCCATGGGCGCTGGAAG -3'
Posted On2014-10-02