Incidental Mutation 'R2198:Thbs4'
ID238523
Institutional Source Beutler Lab
Gene Symbol Thbs4
Ensembl Gene ENSMUSG00000021702
Gene Namethrombospondin 4
SynonymsTSP-4, TSP4
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92751590-92794818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92763271 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 491 (Y491H)
Ref Sequence ENSEMBL: ENSMUSP00000022213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022213
AA Change: Y491H

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: Y491H

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
TSPN 26 194 1.66e-51 SMART
Pfam:COMP 220 264 1.2e-24 PFAM
low complexity region 280 290 N/A INTRINSIC
EGF 291 327 1.04e-3 SMART
EGF_CA 328 380 7.29e-8 SMART
EGF_CA 381 421 1.42e-10 SMART
EGF 425 464 4.32e-1 SMART
Pfam:TSP_3 498 533 7.1e-15 PFAM
Pfam:TSP_3 557 592 7.8e-17 PFAM
Pfam:TSP_3 616 653 1.4e-11 PFAM
Pfam:TSP_3 654 693 1.3e-10 PFAM
Pfam:TSP_3 694 729 1e-14 PFAM
Pfam:TSP_C 747 944 3.8e-102 PFAM
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Thbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Thbs4 APN 13 92776980 missense probably benign 0.04
IGL02318:Thbs4 APN 13 92763584 missense probably damaging 1.00
IGL02887:Thbs4 APN 13 92790798 missense probably benign 0.00
IGL03205:Thbs4 APN 13 92762774 missense probably damaging 1.00
IGL03382:Thbs4 APN 13 92769548 missense probably benign 0.37
R0087:Thbs4 UTSW 13 92755235 missense probably damaging 0.99
R0128:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0130:Thbs4 UTSW 13 92754410 missense probably benign 0.00
R0276:Thbs4 UTSW 13 92775532 missense probably benign 0.00
R0423:Thbs4 UTSW 13 92756571 missense probably damaging 0.99
R0504:Thbs4 UTSW 13 92767184 missense probably benign 0.04
R0708:Thbs4 UTSW 13 92773186 missense probably damaging 1.00
R0836:Thbs4 UTSW 13 92758038 missense probably damaging 1.00
R1078:Thbs4 UTSW 13 92762926 splice site probably benign
R1139:Thbs4 UTSW 13 92774718 missense probably damaging 1.00
R1253:Thbs4 UTSW 13 92776905 missense probably benign 0.17
R1342:Thbs4 UTSW 13 92752417 missense probably damaging 1.00
R1416:Thbs4 UTSW 13 92761533 missense probably benign
R1834:Thbs4 UTSW 13 92761481 missense probably benign 0.00
R1950:Thbs4 UTSW 13 92769571 missense probably damaging 0.99
R2056:Thbs4 UTSW 13 92790879 missense probably benign 0.00
R2184:Thbs4 UTSW 13 92774794 missense probably benign
R2859:Thbs4 UTSW 13 92790708 missense probably benign 0.02
R3605:Thbs4 UTSW 13 92757959 nonsense probably null
R3783:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3784:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3786:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R3787:Thbs4 UTSW 13 92773164 missense probably benign 0.09
R4061:Thbs4 UTSW 13 92776097 critical splice donor site probably null
R4790:Thbs4 UTSW 13 92762806 missense probably damaging 1.00
R4968:Thbs4 UTSW 13 92758068 missense possibly damaging 0.55
R4983:Thbs4 UTSW 13 92790699 missense probably benign 0.29
R5185:Thbs4 UTSW 13 92775167 missense probably damaging 0.97
R5352:Thbs4 UTSW 13 92763590 missense probably damaging 1.00
R5361:Thbs4 UTSW 13 92776993 missense probably benign
R5589:Thbs4 UTSW 13 92776074 splice site probably null
R5700:Thbs4 UTSW 13 92776953 missense probably benign 0.00
R6061:Thbs4 UTSW 13 92751795 missense probably benign 0.00
R6101:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6105:Thbs4 UTSW 13 92775485 missense possibly damaging 0.90
R6227:Thbs4 UTSW 13 92774682 missense probably null 1.00
R6249:Thbs4 UTSW 13 92774707 missense probably damaging 1.00
R6651:Thbs4 UTSW 13 92756536 missense probably benign 0.06
R6735:Thbs4 UTSW 13 92755166 missense possibly damaging 0.71
R6885:Thbs4 UTSW 13 92762869 missense probably damaging 0.96
R6913:Thbs4 UTSW 13 92757936 missense possibly damaging 0.94
R7409:Thbs4 UTSW 13 92773259 nonsense probably null
R7480:Thbs4 UTSW 13 92767221 missense probably benign 0.00
R7682:Thbs4 UTSW 13 92775562 missense probably benign 0.21
R8022:Thbs4 UTSW 13 92752447 missense probably damaging 1.00
R8213:Thbs4 UTSW 13 92760586 critical splice acceptor site probably null
R8231:Thbs4 UTSW 13 92774844 missense probably benign
R8353:Thbs4 UTSW 13 92790817 missense probably benign 0.04
Z1177:Thbs4 UTSW 13 92754376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGGAATGAGTAGCATCAGC -3'
(R):5'- GCCCTGTCTTAAATGGCTTTG -3'

Sequencing Primer
(F):5'- CAACTGGCTGCAAAGGCTTG -3'
(R):5'- CCCTGTCTTAAATGGCTTTGGGAAG -3'
Posted On2014-10-02