Incidental Mutation 'R1188:Celf6'
ID102365
Institutional Source Beutler Lab
Gene Symbol Celf6
Ensembl Gene ENSMUSG00000032297
Gene NameCUGBP, Elav-like family member 6
Synonyms6330569O16Rik, Brunol6
MMRRC Submission 039260-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1188 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59577917-59607292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59590678 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 130 (R130L)
Ref Sequence ENSEMBL: ENSMUSP00000112755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034840] [ENSMUST00000118164] [ENSMUST00000118549] [ENSMUST00000121266] [ENSMUST00000129357] [ENSMUST00000143916]
Predicted Effect probably benign
Transcript: ENSMUST00000034840
AA Change: R130L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034840
Gene: ENSMUSG00000032297
AA Change: R130L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
RRM 135 210 1.05e-17 SMART
low complexity region 252 294 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
RRM 376 449 7.35e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118164
AA Change: R15L

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112403
Gene: ENSMUSG00000032297
AA Change: R15L

DomainStartEndE-ValueType
RRM 20 95 1.05e-17 SMART
low complexity region 137 179 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
RRM 260 333 7.35e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118549
AA Change: R130L

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112755
Gene: ENSMUSG00000032297
AA Change: R130L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
RRM 135 210 1.05e-17 SMART
low complexity region 252 294 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
low complexity region 356 375 N/A INTRINSIC
RRM 397 470 7.35e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121266
AA Change: R15L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113196
Gene: ENSMUSG00000032297
AA Change: R15L

DomainStartEndE-ValueType
RRM 20 95 1.05e-17 SMART
low complexity region 137 179 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
RRM 261 334 7.35e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129357
SMART Domains Protein: ENSMUSP00000122167
Gene: ENSMUSG00000032297

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 121 1e-14 SMART
low complexity region 138 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143916
AA Change: R130L

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118556
Gene: ENSMUSG00000032297
AA Change: R130L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
RRM 47 123 2.16e-19 SMART
Pfam:RRM_1 136 177 1.5e-7 PFAM
Pfam:RRM_6 136 177 3.7e-6 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ultrasonic vocalization, decreased brain serotonin levels, and selective behavioral deficits including an abnormal response to novel odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 65,990,398 Y14C unknown Het
Afap1l2 T C 19: 56,925,069 K312E probably damaging Het
Amigo2 T A 15: 97,245,713 E276V probably benign Het
Asna1 A G 8: 85,019,793 I142T probably damaging Het
Atf2 A G 2: 73,845,537 F114L probably damaging Het
Avpr1a G T 10: 122,448,919 G39C possibly damaging Het
Ccpg1 A G 9: 73,012,506 R468G possibly damaging Het
Dsp T C 13: 38,194,963 S1296P probably damaging Het
Fnip2 C T 3: 79,462,162 R1072H probably damaging Het
Fsip2 G T 2: 82,975,017 C560F possibly damaging Het
Gpr20 A C 15: 73,695,768 H257Q probably damaging Het
Gys2 T A 6: 142,455,183 H297L probably damaging Het
Habp2 G A 19: 56,311,722 S201N probably benign Het
Hars2 T C 18: 36,787,969 I198T probably damaging Het
Jag2 G A 12: 112,920,121 Q247* probably null Het
Jam2 A G 16: 84,806,867 T81A probably damaging Het
Mrps26 G A 2: 130,564,381 E145K probably damaging Het
Nup210l T C 3: 90,198,179 F1545L probably benign Het
Olfr961 A G 9: 39,647,476 Y250C probably damaging Het
Pikfyve T A 1: 65,246,959 V1074D possibly damaging Het
Prkag1 T A 15: 98,814,598 I118F probably damaging Het
R3hdm2 G A 10: 127,452,755 V91I probably benign Het
Rnf168 T C 16: 32,298,659 V346A probably benign Het
Slc17a7 T C 7: 45,169,887 V129A possibly damaging Het
Snai3 T A 8: 122,454,962 Q252L probably damaging Het
Snx17 T C 5: 31,195,822 V133A probably benign Het
Stt3a A G 9: 36,751,340 S59P probably damaging Het
Sun1 C T 5: 139,238,856 R546C probably damaging Het
Thsd4 T A 9: 60,394,406 Q202L probably benign Het
Tnrc6b A G 15: 80,879,229 T311A probably benign Het
Tshr T A 12: 91,502,168 D18E probably benign Het
Ttn A T 2: 76,789,429 L15965Q probably damaging Het
Wnk1 C A 6: 119,948,709 E1265* probably null Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Celf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Celf6 APN 9 59603525 missense probably damaging 0.98
IGL03172:Celf6 APN 9 59582282 missense probably damaging 1.00
R0119:Celf6 UTSW 9 59602878 missense probably benign 0.00
R0299:Celf6 UTSW 9 59602878 missense probably benign 0.00
R0499:Celf6 UTSW 9 59602878 missense probably benign 0.00
R1543:Celf6 UTSW 9 59603877 splice site probably benign
R2198:Celf6 UTSW 9 59603339 missense possibly damaging 0.95
R2207:Celf6 UTSW 9 59604327 missense possibly damaging 0.93
R4460:Celf6 UTSW 9 59603044 missense probably damaging 1.00
R6908:Celf6 UTSW 9 59603823 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCCCGAGTCTAAGACAGAAGAGTG -3'
(R):5'- TGAGTCTGAATTGGAATGGCTGAGC -3'

Sequencing Primer
(F):5'- ACAGAAGAGTGTCTTTGCCC -3'
(R):5'- TTCCAGACTTCCCTGACCTA -3'
Posted On2014-01-15