Incidental Mutation 'R2201:Zscan29'
ID238637
Institutional Source Beutler Lab
Gene Symbol Zscan29
Ensembl Gene ENSMUSG00000050619
Gene Namezinc finger SCAN domains 29
SynonymsZfp690
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121158273-121171125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 121169402 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 106 (V106G)
Ref Sequence ENSEMBL: ENSMUSP00000125987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000079024] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000110661] [ENSMUST00000146243] [ENSMUST00000163766] [ENSMUST00000186659]
Predicted Effect probably benign
Transcript: ENSMUST00000039541
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079024
AA Change: V106G

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619
AA Change: V106G

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 3e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110657
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110658
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110661
AA Change: V106G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619
AA Change: V106G

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.4e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 7.4e-22 PFAM
low complexity region 518 532 N/A INTRINSIC
ZnF_C2H2 665 687 2.99e-4 SMART
ZnF_C2H2 693 715 2.75e-3 SMART
ZnF_C2H2 721 743 8.02e-5 SMART
ZnF_C2H2 749 771 1.13e-4 SMART
ZnF_C2H2 777 799 1.18e-2 SMART
ZnF_C2H2 805 827 1.33e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144123
Predicted Effect probably benign
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156370
Predicted Effect probably damaging
Transcript: ENSMUST00000163766
AA Change: V106G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619
AA Change: V106G

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186659
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Meta Mutation Damage Score 0.5449 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Other mutations in Zscan29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Zscan29 APN 2 121170057 missense probably damaging 1.00
IGL01938:Zscan29 APN 2 121166209 missense probably benign 0.16
IGL02220:Zscan29 APN 2 121166689 missense probably damaging 0.99
IGL02370:Zscan29 APN 2 121163833 missense probably benign 0.00
IGL02585:Zscan29 APN 2 121163876 nonsense probably null
R0284:Zscan29 UTSW 2 121166733 unclassified probably benign
R0842:Zscan29 UTSW 2 121161479 missense possibly damaging 0.84
R1245:Zscan29 UTSW 2 121166503 missense probably damaging 1.00
R1586:Zscan29 UTSW 2 121161160 missense probably damaging 1.00
R1654:Zscan29 UTSW 2 121164779 missense probably benign 0.06
R1958:Zscan29 UTSW 2 121169808 critical splice donor site probably null
R2073:Zscan29 UTSW 2 121160855 nonsense probably null
R2085:Zscan29 UTSW 2 121169946 nonsense probably null
R2145:Zscan29 UTSW 2 121170106 missense probably damaging 1.00
R2875:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R2876:Zscan29 UTSW 2 121164100 missense probably damaging 1.00
R3861:Zscan29 UTSW 2 121160731 missense probably benign 0.01
R4244:Zscan29 UTSW 2 121164794 unclassified probably null
R4245:Zscan29 UTSW 2 121164794 unclassified probably null
R4447:Zscan29 UTSW 2 121169886 unclassified probably null
R4662:Zscan29 UTSW 2 121166615 missense probably benign 0.26
R4757:Zscan29 UTSW 2 121160911 missense possibly damaging 0.92
R4777:Zscan29 UTSW 2 121169324 missense probably damaging 0.96
R4905:Zscan29 UTSW 2 121161383 missense possibly damaging 0.53
R4970:Zscan29 UTSW 2 121169195 splice site probably null
R5860:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5861:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5862:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5916:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5917:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R5918:Zscan29 UTSW 2 121164037 missense probably damaging 1.00
R6335:Zscan29 UTSW 2 121161436 missense possibly damaging 0.49
R7214:Zscan29 UTSW 2 121169280 nonsense probably null
R7326:Zscan29 UTSW 2 121160988 missense probably damaging 1.00
R7997:Zscan29 UTSW 2 121160740 missense probably benign 0.01
RF001:Zscan29 UTSW 2 121163996 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCACCGCTCCTTTGAAAAG -3'
(R):5'- GGGAAGTTTCTTTTCCAGCTGC -3'

Sequencing Primer
(F):5'- AAAAGGTCTGAGATTCTCCTTTGG -3'
(R):5'- CCAGCTGCTATTTGGGTTTC -3'
Posted On2014-10-02