Incidental Mutation 'R2212:Krt84'
ID239475
Institutional Source Beutler Lab
Gene Symbol Krt84
Ensembl Gene ENSMUSG00000044294
Gene Namekeratin 84
SynonymsKrt2-3, Krt2-16, HRb-1
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101525026-101532820 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101532538 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 73 (V73G)
Ref Sequence ENSEMBL: ENSMUSP00000023720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023720]
Predicted Effect probably benign
Transcript: ENSMUST00000023720
AA Change: V73G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000023720
Gene: ENSMUSG00000044294
AA Change: V73G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 169 3.9e-39 PFAM
Filament 172 483 4.05e-163 SMART
low complexity region 535 560 N/A INTRINSIC
low complexity region 574 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229893
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin is contained primarily in the filiform tongue papilla, among other hair keratins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Krt84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Krt84 APN 15 101528735 missense probably damaging 1.00
IGL00227:Krt84 APN 15 101527773 missense probably benign 0.08
IGL01352:Krt84 APN 15 101528774 missense probably damaging 1.00
IGL01523:Krt84 APN 15 101528744 missense probably damaging 1.00
IGL01797:Krt84 APN 15 101528480 missense possibly damaging 0.93
IGL01874:Krt84 APN 15 101527804 missense probably damaging 1.00
IGL02044:Krt84 APN 15 101528496 missense probably damaging 1.00
IGL02183:Krt84 APN 15 101532356 missense unknown
IGL02455:Krt84 APN 15 101525735 missense unknown
IGL03023:Krt84 APN 15 101528445 missense possibly damaging 0.74
R0102:Krt84 UTSW 15 101528703 missense probably damaging 0.99
R0102:Krt84 UTSW 15 101528703 missense probably damaging 0.99
R0103:Krt84 UTSW 15 101530236 missense probably damaging 1.00
R0423:Krt84 UTSW 15 101528720 missense probably damaging 1.00
R0704:Krt84 UTSW 15 101532677 missense probably benign 0.00
R1500:Krt84 UTSW 15 101530224 missense probably damaging 0.99
R1647:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1650:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1651:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1652:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1731:Krt84 UTSW 15 101525963 missense possibly damaging 0.95
R1999:Krt84 UTSW 15 101529584 missense possibly damaging 0.76
R2106:Krt84 UTSW 15 101530866 missense probably damaging 1.00
R2150:Krt84 UTSW 15 101529584 missense possibly damaging 0.76
R2397:Krt84 UTSW 15 101530254 missense probably benign 0.18
R4722:Krt84 UTSW 15 101528411 missense probably damaging 1.00
R4926:Krt84 UTSW 15 101530254 missense probably benign 0.18
R5634:Krt84 UTSW 15 101528649 missense probably benign 0.30
R5807:Krt84 UTSW 15 101530212 missense probably damaging 1.00
R5978:Krt84 UTSW 15 101530230 missense probably damaging 1.00
R6524:Krt84 UTSW 15 101532752 missense unknown
R7032:Krt84 UTSW 15 101528489 missense probably benign 0.13
R7155:Krt84 UTSW 15 101532254 missense probably damaging 1.00
R7159:Krt84 UTSW 15 101529609 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCCGATTCTGTAGCCAAAGCC -3'
(R):5'- ATGTCTTGCCGCTCCTACAG -3'

Sequencing Primer
(F):5'- GCCAGGGCCACCAAAGC -3'
(R):5'- TTGCCGCTCCTACAGAGTCAG -3'
Posted On2014-10-15