Mutagenetix > Incidental Mutations

Incidental Mutation 'R2212:Krt84'

239475

Institutional Source

Beutler Lab

Gene Symbol

Krt84

Ensembl Gene

ENSMUSG00000044294

Gene Name

keratin 84

Synonyms

Krt2-3, Krt2-16, HRb-1

MMRRC Submission

040214-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R2212 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101525026-101532820 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 101532538 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 73 (V73G)

Ref Sequence

ENSEMBL: ENSMUSP00000023720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023720]

Predicted Effect

probably benign
Transcript: ENSMUST00000023720
AA Change: V73G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000023720
Gene: ENSMUSG00000044294
AA Change: V73G

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	169	3.9e-39	PFAM
Filament	172	483	4.05e-163	SMART
low complexity region	535	560	N/A	INTRINSIC
low complexity region	574	602	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229893

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin is contained primarily in the filiform tongue papilla, among other hair keratins. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	A	G	18: 24,470,920	Y6C	probably damaging	Het
3425401B19Rik	T	A	14: 32,661,602	Q802L	probably benign	Het
Adarb2	T	C	13: 8,752,618	F643S	probably damaging	Het
Angptl4	A	G	17: 33,775,418	I401T	probably damaging	Het
Ap2a2	T	A	7: 141,598,776	N105K	probably benign	Het
Atp8b4	C	A	2: 126,375,757	W613L	probably damaging	Het
Coq10a	A	G	10: 128,365,129	V93A	possibly damaging	Het
Cyp4f39	A	T	17: 32,487,063	E376V	possibly damaging	Het
Deup1	A	T	9: 15,599,843	D213E	probably benign	Het
Ehmt2	A	G	17: 34,899,365	S39G	probably benign	Het
Eya1	T	A	1: 14,274,209		probably null	Het
Fam92a	A	G	4: 12,171,696		probably null	Het
Fcna	G	C	2: 25,627,493	P49A	probably damaging	Het
Flnb	AAGGAG	AAG	14: 7,881,652		probably benign	Het
Fscn2	G	T	11: 120,361,591		probably benign	Het
Gckr	T	A	5: 31,300,867		probably null	Het
Golgb1	A	G	16: 36,887,347	K68E	probably damaging	Het
H2-M11	G	A	17: 36,548,930	V272M	probably damaging	Het
Hace1	T	A	10: 45,648,675	D234E	possibly damaging	Het
Il18r1	A	T	1: 40,491,067	D318V	probably damaging	Het
Il4i1	T	C	7: 44,836,658	L22P	probably damaging	Het
Kcnq3	A	T	15: 66,020,293	F411Y	probably benign	Het
Kcnt2	A	G	1: 140,530,800	Y775C	probably damaging	Het
Lcp2	A	C	11: 34,070,995	D117A	probably benign	Het
Lemd1	C	A	1: 132,228,286	T22K	probably benign	Het
Mdm4	T	C	1: 132,994,522	D294G	probably damaging	Het
Mep1a	G	A	17: 43,477,263	A634V	probably benign	Het
Myh15	A	G	16: 49,138,732	D989G	probably benign	Het
Myo1g	G	T	11: 6,517,870	H188Q	possibly damaging	Het
Nsmaf	C	A	4: 6,396,732	L918F	probably damaging	Het
Olfr1396	C	T	11: 49,113,216	C170Y	probably damaging	Het
Olfr561	T	C	7: 102,774,755	L77P	possibly damaging	Het
Olfr635	T	C	7: 103,979,402	L76P	probably damaging	Het
Olfr963	T	A	9: 39,669,228	M57K	probably damaging	Het
Pfkfb2	A	T	1: 130,707,532	N97K	probably damaging	Het
Phlda1	A	T	10: 111,507,168	E255V	probably damaging	Het
Pla2g4f	T	C	2: 120,303,106	S579G	probably benign	Het
Plcz1	C	T	6: 140,002,081	R525Q	probably damaging	Het
Ppargc1b	G	A	18: 61,311,220	Q291*	probably null	Het
Ppef2	T	G	5: 92,228,722	S649R	probably damaging	Het
Ppp1r3b	A	G	8: 35,384,225	T73A	possibly damaging	Het
Prss43	G	C	9: 110,829,464	Q277H	probably damaging	Het
Rusc2	T	G	4: 43,415,935	S414A	probably damaging	Het
Serpina3j	G	A	12: 104,314,726	D53N	probably damaging	Het
Sez6l	A	G	5: 112,475,361	L108P	possibly damaging	Het
Slc1a7	A	G	4: 108,010,994	E497G	probably benign	Het
Spag8	T	A	4: 43,651,606	S423C	probably damaging	Het
Spata13	A	G	14: 60,706,723	T522A	probably benign	Het
Spryd3	A	G	15: 102,130,276		probably null	Het
Sry	T	A	Y: 2,663,339	N107I	probably damaging	Het
St6galnac1	A	G	11: 116,765,856	W486R	probably damaging	Het
Syt1	G	T	10: 108,504,414	P348T	possibly damaging	Het
Taok2	T	C	7: 126,870,858	I933V	possibly damaging	Het
Tex9	C	A	9: 72,477,758	Q265H	possibly damaging	Het
Tmem63a	G	A	1: 180,963,114	D446N	possibly damaging	Het
Trim59	T	C	3: 69,037,543	T155A	probably benign	Het
Trim69	T	C	2: 122,178,644	V395A	probably benign	Het
Tusc1	C	A	4: 93,334,936	R162L	probably damaging	Het
Ubash3a	A	T	17: 31,218,034	Q208H	probably damaging	Het
Ubn2	A	G	6: 38,498,739	T1211A	probably benign	Het
Vmn2r110	A	T	17: 20,573,947		probably null	Het
Vrk3	C	T	7: 44,775,442	T427M	probably benign	Het
Zfyve28	C	T	5: 34,199,684	M723I	probably benign	Het
Zmynd8	A	T	2: 165,815,451	M533K	probably damaging	Het

Other mutations in Krt84

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Krt84	APN	15	101528735	missense	probably damaging	1.00
IGL00227:Krt84	APN	15	101527773	missense	probably benign	0.08
IGL01352:Krt84	APN	15	101528774	missense	probably damaging	1.00
IGL01523:Krt84	APN	15	101528744	missense	probably damaging	1.00
IGL01797:Krt84	APN	15	101528480	missense	possibly damaging	0.93
IGL01874:Krt84	APN	15	101527804	missense	probably damaging	1.00
IGL02044:Krt84	APN	15	101528496	missense	probably damaging	1.00
IGL02183:Krt84	APN	15	101532356	missense	unknown
IGL02455:Krt84	APN	15	101525735	missense	unknown
IGL03023:Krt84	APN	15	101528445	missense	possibly damaging	0.74
R0102:Krt84	UTSW	15	101528703	missense	probably damaging	0.99
R0102:Krt84	UTSW	15	101528703	missense	probably damaging	0.99
R0103:Krt84	UTSW	15	101530236	missense	probably damaging	1.00
R0423:Krt84	UTSW	15	101528720	missense	probably damaging	1.00
R0704:Krt84	UTSW	15	101532677	missense	probably benign	0.00
R1500:Krt84	UTSW	15	101530224	missense	probably damaging	0.99
R1647:Krt84	UTSW	15	101525963	missense	possibly damaging	0.95
R1650:Krt84	UTSW	15	101525963	missense	possibly damaging	0.95
R1651:Krt84	UTSW	15	101525963	missense	possibly damaging	0.95
R1652:Krt84	UTSW	15	101525963	missense	possibly damaging	0.95
R1731:Krt84	UTSW	15	101525963	missense	possibly damaging	0.95
R1999:Krt84	UTSW	15	101529584	missense	possibly damaging	0.76
R2106:Krt84	UTSW	15	101530866	missense	probably damaging	1.00
R2150:Krt84	UTSW	15	101529584	missense	possibly damaging	0.76
R2397:Krt84	UTSW	15	101530254	missense	probably benign	0.18
R4722:Krt84	UTSW	15	101528411	missense	probably damaging	1.00
R4926:Krt84	UTSW	15	101530254	missense	probably benign	0.18
R5634:Krt84	UTSW	15	101528649	missense	probably benign	0.30
R5807:Krt84	UTSW	15	101530212	missense	probably damaging	1.00
R5978:Krt84	UTSW	15	101530230	missense	probably damaging	1.00
R6524:Krt84	UTSW	15	101532752	missense	unknown
R7032:Krt84	UTSW	15	101528489	missense	probably benign	0.13
R7155:Krt84	UTSW	15	101532254	missense	probably damaging	1.00
R7159:Krt84	UTSW	15	101529609	nonsense	probably null
R7882:Krt84	UTSW	15	101528391	missense	probably benign	0.04
R8492:Krt84	UTSW	15	101529616	missense	probably damaging	1.00
Z1177:Krt84	UTSW	15	101525982	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTCCGATTCTGTAGCCAAAGCC -3'
(R):5'- ATGTCTTGCCGCTCCTACAG -3'

Sequencing Primer
(F):5'- GCCAGGGCCACCAAAGC -3'
(R):5'- TTGCCGCTCCTACAGAGTCAG -3'

Posted On

2014-10-15