Incidental Mutation 'R2212:Kcnq3'
ID239474
Institutional Source Beutler Lab
Gene Symbol Kcnq3
Ensembl Gene ENSMUSG00000056258
Gene Namepotassium voltage-gated channel, subfamily Q, member 3
Synonyms
MMRRC Submission 040214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location65986387-66286642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66020293 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 411 (F411Y)
Ref Sequence ENSEMBL: ENSMUSP00000063380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070256]
Predicted Effect probably benign
Transcript: ENSMUST00000070256
AA Change: F411Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063380
Gene: ENSMUSG00000056258
AA Change: F411Y

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Pfam:Ion_trans 122 364 9.9e-31 PFAM
Pfam:Ion_trans_2 268 357 3.4e-14 PFAM
Pfam:KCNQ_channel 448 658 1.4e-89 PFAM
Pfam:KCNQC3-Ank-G_bd 771 867 3.8e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183354
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the regulation of neuronal excitability. The encoded protein forms an M-channel by associating with the products of the related KCNQ2 or KCNQ5 genes, which both encode integral membrane proteins. M-channel currents are inhibited by M1 muscarinic acetylcholine receptors and are activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 2 (BFNC2), also known as epilepsy, benign neonatal type 2 (EBN2). Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal apamin-insensitive afterhyperpolarization currents in granule cells, but not pyramidal cells, of the hippocampus. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Kcnq3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnq3 APN 15 65995271 missense probably damaging 1.00
IGL00808:Kcnq3 APN 15 65995754 missense possibly damaging 0.49
IGL00969:Kcnq3 APN 15 66004726 missense probably damaging 1.00
IGL01121:Kcnq3 APN 15 66005977 splice site probably benign
IGL01996:Kcnq3 APN 15 66023696 missense probably damaging 0.98
IGL02153:Kcnq3 APN 15 66025191 missense probably damaging 0.96
IGL02950:Kcnq3 APN 15 66020293 missense probably benign 0.12
IGL02963:Kcnq3 APN 15 66285826 splice site probably benign
IGL03102:Kcnq3 APN 15 66028788 missense probably damaging 1.00
IGL03050:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R0345:Kcnq3 UTSW 15 66020305 missense possibly damaging 0.55
R0388:Kcnq3 UTSW 15 66000038 missense probably benign 0.00
R0730:Kcnq3 UTSW 15 65995608 missense probably benign
R1173:Kcnq3 UTSW 15 66000042 missense probably benign 0.01
R1610:Kcnq3 UTSW 15 66025260 missense probably damaging 1.00
R1678:Kcnq3 UTSW 15 66031432 missense probably damaging 1.00
R1714:Kcnq3 UTSW 15 66000063 missense probably benign 0.21
R1755:Kcnq3 UTSW 15 65995421 missense probably damaging 1.00
R1768:Kcnq3 UTSW 15 66005906 missense probably damaging 0.98
R1873:Kcnq3 UTSW 15 66002255 missense probably benign 0.16
R1925:Kcnq3 UTSW 15 66004809 missense possibly damaging 0.75
R1970:Kcnq3 UTSW 15 66028623 critical splice donor site probably null
R2140:Kcnq3 UTSW 15 66005978 splice site probably benign
R2141:Kcnq3 UTSW 15 65995851 missense probably benign 0.21
R2149:Kcnq3 UTSW 15 66023729 missense probably damaging 1.00
R2272:Kcnq3 UTSW 15 66028680 missense probably damaging 1.00
R2566:Kcnq3 UTSW 15 66031427 missense probably damaging 1.00
R2909:Kcnq3 UTSW 15 66025236 missense possibly damaging 0.87
R3703:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3704:Kcnq3 UTSW 15 66021739 critical splice donor site probably null
R3899:Kcnq3 UTSW 15 66030523 missense probably benign 0.01
R4096:Kcnq3 UTSW 15 66285815 intron probably null
R4421:Kcnq3 UTSW 15 65995511 missense probably benign 0.01
R4504:Kcnq3 UTSW 15 65995342 nonsense probably null
R4505:Kcnq3 UTSW 15 65995342 nonsense probably null
R4571:Kcnq3 UTSW 15 66030612 missense probably damaging 1.00
R4577:Kcnq3 UTSW 15 66286214 missense unknown
R4900:Kcnq3 UTSW 15 65995410 missense probably damaging 1.00
R4981:Kcnq3 UTSW 15 66031405 missense possibly damaging 0.84
R5015:Kcnq3 UTSW 15 66004763 missense probably damaging 1.00
R5049:Kcnq3 UTSW 15 66285897 missense probably benign 0.17
R5245:Kcnq3 UTSW 15 66031435 missense possibly damaging 0.89
R5334:Kcnq3 UTSW 15 66025224 missense probably damaging 1.00
R5528:Kcnq3 UTSW 15 66025178 missense probably damaging 0.97
R5532:Kcnq3 UTSW 15 65997773 nonsense probably null
R5630:Kcnq3 UTSW 15 66025122 missense probably damaging 1.00
R5639:Kcnq3 UTSW 15 65997750 missense probably damaging 0.96
R5936:Kcnq3 UTSW 15 66000110 missense probably damaging 1.00
R6306:Kcnq3 UTSW 15 66004794 missense probably benign 0.40
R6576:Kcnq3 UTSW 15 66025178 missense possibly damaging 0.52
R7006:Kcnq3 UTSW 15 66020316 nonsense probably null
R7403:Kcnq3 UTSW 15 66002217 missense probably damaging 1.00
RF045:Kcnq3 UTSW 15 66286184 small deletion probably benign
X0060:Kcnq3 UTSW 15 66031386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGCGCCATGTTGTTTACATC -3'
(R):5'- GAAACCAAGAATCTCTGCTTTTCTG -3'

Sequencing Primer
(F):5'- TAGGTGCCCACTGGAATCATCTAG -3'
(R):5'- AGAATCTCTGCTTTTCTGAATCCTAG -3'
Posted On2014-10-15