Incidental Mutation 'R2212:Ubn2'
ID239445
Institutional Source Beutler Lab
Gene Symbol Ubn2
Ensembl Gene ENSMUSG00000038538
Gene Nameubinuclein 2
SynonymsD130059P03Rik, 6030408G03Rik, 2900060J04Rik
MMRRC Submission 040214-MU
Accession Numbers

Genbank: NM_177185; MGI: 2444236

Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R2212 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location38433950-38524825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38498739 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1211 (T1211A)
Ref Sequence ENSEMBL: ENSMUSP00000036188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039127] [ENSMUST00000160583] [ENSMUST00000162593]
Predicted Effect probably benign
Transcript: ENSMUST00000039127
AA Change: T1211A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036188
Gene: ENSMUSG00000038538
AA Change: T1211A

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 180 231 4.8e-22 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 6.4e-80 PFAM
low complexity region 687 717 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
low complexity region 846 881 N/A INTRINSIC
low complexity region 1002 1042 N/A INTRINSIC
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1180 1199 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
low complexity region 1280 1297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159447
SMART Domains Protein: ENSMUSP00000123836
Gene: ENSMUSG00000038538

DomainStartEndE-ValueType
low complexity region 119 159 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159925
Predicted Effect probably benign
Transcript: ENSMUST00000160583
AA Change: T1209A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124043
Gene: ENSMUSG00000038538
AA Change: T1209A

DomainStartEndE-ValueType
low complexity region 34 57 N/A INTRINSIC
low complexity region 74 109 N/A INTRINSIC
Pfam:HUN 178 232 3.8e-23 PFAM
low complexity region 256 285 N/A INTRINSIC
low complexity region 294 309 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Pfam:UBN_AB 434 650 2.9e-86 PFAM
low complexity region 685 715 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 844 879 N/A INTRINSIC
low complexity region 1000 1040 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1178 1197 N/A INTRINSIC
low complexity region 1245 1261 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162593
SMART Domains Protein: ENSMUSP00000124352
Gene: ENSMUSG00000038538

DomainStartEndE-ValueType
Pfam:HUN 10 64 4.4e-24 PFAM
low complexity region 88 117 N/A INTRINSIC
low complexity region 126 141 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Pfam:UBN_AB 266 482 3.1e-87 PFAM
low complexity region 534 564 N/A INTRINSIC
low complexity region 669 680 N/A INTRINSIC
low complexity region 693 728 N/A INTRINSIC
low complexity region 849 889 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
low complexity region 1027 1039 N/A INTRINSIC
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,470,920 Y6C probably damaging Het
3425401B19Rik T A 14: 32,661,602 Q802L probably benign Het
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Angptl4 A G 17: 33,775,418 I401T probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Cyp4f39 A T 17: 32,487,063 E376V possibly damaging Het
Deup1 A T 9: 15,599,843 D213E probably benign Het
Ehmt2 A G 17: 34,899,365 S39G probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fam92a A G 4: 12,171,696 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Flnb AAGGAG AAG 14: 7,881,652 probably benign Het
Fscn2 G T 11: 120,361,591 probably benign Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
H2-M11 G A 17: 36,548,930 V272M probably damaging Het
Hace1 T A 10: 45,648,675 D234E possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Kcnq3 A T 15: 66,020,293 F411Y probably benign Het
Kcnt2 A G 1: 140,530,800 Y775C probably damaging Het
Krt84 A C 15: 101,532,538 V73G probably benign Het
Lcp2 A C 11: 34,070,995 D117A probably benign Het
Lemd1 C A 1: 132,228,286 T22K probably benign Het
Mdm4 T C 1: 132,994,522 D294G probably damaging Het
Mep1a G A 17: 43,477,263 A634V probably benign Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nsmaf C A 4: 6,396,732 L918F probably damaging Het
Olfr1396 C T 11: 49,113,216 C170Y probably damaging Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr963 T A 9: 39,669,228 M57K probably damaging Het
Pfkfb2 A T 1: 130,707,532 N97K probably damaging Het
Phlda1 A T 10: 111,507,168 E255V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppargc1b G A 18: 61,311,220 Q291* probably null Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Ppp1r3b A G 8: 35,384,225 T73A possibly damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Serpina3j G A 12: 104,314,726 D53N probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Spata13 A G 14: 60,706,723 T522A probably benign Het
Spryd3 A G 15: 102,130,276 probably null Het
Sry T A Y: 2,663,339 N107I probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syt1 G T 10: 108,504,414 P348T possibly damaging Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim59 T C 3: 69,037,543 T155A probably benign Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubash3a A T 17: 31,218,034 Q208H probably damaging Het
Vmn2r110 A T 17: 20,573,947 probably null Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Ubn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Ubn2 APN 6 38482605 missense possibly damaging 0.91
IGL03116:Ubn2 APN 6 38491899 missense probably damaging 1.00
IGL03150:Ubn2 APN 6 38463714 missense probably benign
IGL03382:Ubn2 APN 6 38440447 unclassified probably benign
A4554:Ubn2 UTSW 6 38484110 missense probably damaging 1.00
R0008:Ubn2 UTSW 6 38434600 critical splice donor site probably null
R0034:Ubn2 UTSW 6 38491406 synonymous silent
R0121:Ubn2 UTSW 6 38452858 splice site probably benign
R0267:Ubn2 UTSW 6 38482618 critical splice donor site probably null
R1864:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1865:Ubn2 UTSW 6 38440490 missense possibly damaging 0.93
R1892:Ubn2 UTSW 6 38491291 missense probably damaging 1.00
R2174:Ubn2 UTSW 6 38470141 splice site probably null
R2184:Ubn2 UTSW 6 38484094 missense probably damaging 1.00
R2442:Ubn2 UTSW 6 38491005 missense probably benign 0.00
R3413:Ubn2 UTSW 6 38498739 missense probably benign 0.03
R4725:Ubn2 UTSW 6 38522305 utr 3 prime probably benign
R4765:Ubn2 UTSW 6 38479140 missense probably damaging 1.00
R4771:Ubn2 UTSW 6 38487153 splice site probably null
R4812:Ubn2 UTSW 6 38463726 missense probably benign
R4934:Ubn2 UTSW 6 38490498 missense probably benign 0.04
R5580:Ubn2 UTSW 6 38483252 missense probably damaging 0.99
R5598:Ubn2 UTSW 6 38490388 missense probably benign 0.00
R5672:Ubn2 UTSW 6 38461527 missense probably damaging 1.00
R5715:Ubn2 UTSW 6 38461477 nonsense probably null
R5817:Ubn2 UTSW 6 38479153 missense probably damaging 1.00
R5919:Ubn2 UTSW 6 38491488 missense possibly damaging 0.50
R5937:Ubn2 UTSW 6 38463982 missense possibly damaging 0.74
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6033:Ubn2 UTSW 6 38470224 critical splice donor site probably null
R6174:Ubn2 UTSW 6 38461536 missense probably damaging 1.00
R6338:Ubn2 UTSW 6 38490714 missense probably benign 0.00
R6653:Ubn2 UTSW 6 38434462 missense possibly damaging 0.72
R7282:Ubn2 UTSW 6 38452876 nonsense probably null
R7685:Ubn2 UTSW 6 38491792 missense probably benign 0.02
R7727:Ubn2 UTSW 6 38463938 missense probably benign 0.08
R7777:Ubn2 UTSW 6 38490753 missense probably damaging 1.00
RF024:Ubn2 UTSW 6 38463628 missense probably damaging 1.00
X0010:Ubn2 UTSW 6 38483120 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTATCACTTGCAAACTTTCAGAACC -3'
(R):5'- AGAGCAGCACTTACTCTGGG -3'

Sequencing Primer
(F):5'- TTTCACCTCAGTCTTAATTTCCTTG -3'
(R):5'- CAGCACTTACTCTGGGTTAGGC -3'
Posted On2014-10-15