Incidental Mutation 'R2217:Timd2'
List |< first << previous [record 38 of 46] next >> last >|
ID241222
Institutional Source Beutler Lab
Gene Symbol Timd2
Ensembl Gene ENSMUSG00000040413
Gene NameT cell immunoglobulin and mucin domain containing 2
SynonymsTIM-2, Tim2
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46668960-46707061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46687017 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 96 (I96L)
Ref Sequence ENSEMBL: ENSMUSP00000131540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055102] [ENSMUST00000109225] [ENSMUST00000125008] [ENSMUST00000169584]
Predicted Effect probably damaging
Transcript: ENSMUST00000055102
AA Change: I96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060891
Gene: ENSMUSG00000040413
AA Change: I96L

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109225
AA Change: I96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104848
Gene: ENSMUSG00000040413
AA Change: I96L

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125008
SMART Domains Protein: ENSMUSP00000123042
Gene: ENSMUSG00000040413

DomainStartEndE-ValueType
PDB:2OR7|B 19 92 6e-50 PDB
Blast:IG 22 92 4e-47 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169584
AA Change: I96L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131540
Gene: ENSMUSG00000040413
AA Change: I96L

DomainStartEndE-ValueType
IG 22 127 7.08e-4 SMART
low complexity region 131 146 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
transmembrane domain 231 253 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slc47a2 T C 11: 61,313,671 T285A probably benign Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Timd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Timd2 APN 11 46676343 missense probably benign 0.15
IGL01289:Timd2 APN 11 46679672 missense probably benign 0.00
IGL02066:Timd2 APN 11 46678223 missense probably damaging 0.98
IGL02439:Timd2 APN 11 46678236 splice site probably benign
R2218:Timd2 UTSW 11 46687017 missense probably damaging 1.00
R2240:Timd2 UTSW 11 46678216 missense probably benign 0.01
R3621:Timd2 UTSW 11 46678213 missense probably benign 0.00
R3876:Timd2 UTSW 11 46671020 critical splice acceptor site probably null
R4173:Timd2 UTSW 11 46670960 missense probably benign 0.00
R4793:Timd2 UTSW 11 46687181 missense probably damaging 1.00
R4799:Timd2 UTSW 11 46677267 nonsense probably null
R4963:Timd2 UTSW 11 46682790 missense possibly damaging 0.66
R5314:Timd2 UTSW 11 46677260 missense probably benign 0.09
R5798:Timd2 UTSW 11 46677237 missense probably benign 0.06
R6074:Timd2 UTSW 11 46687172 missense possibly damaging 0.88
R6090:Timd2 UTSW 11 46687236 missense probably benign 0.11
R6694:Timd2 UTSW 11 46670952 nonsense probably null
R7817:Timd2 UTSW 11 46670954 missense probably benign 0.00
Z1177:Timd2 UTSW 11 46679679 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAACGGGTGTTTTAATGTCCTCAG -3'
(R):5'- GTCTCATACAGCAGTGCAGG -3'

Sequencing Primer
(F):5'- GTCCTCAGGTGTAATTACAGACTAG -3'
(R):5'- ACACTTCCATGTATTTATTCGACAC -3'
Posted On2014-10-15