Mutagenetix > Incidental Mutations

Incidental Mutation 'R2217:Map3k6'

241201

Institutional Source

Beutler Lab

Gene Symbol

Map3k6

Ensembl Gene

ENSMUSG00000028862

Gene Name

mitogen-activated protein kinase kinase kinase 6

Synonyms

Ask2, MAPKKK6, MEKK6

MMRRC Submission

040219-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R2217 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

133240818-133252929 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 133246672 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 487 (H487Q)

Ref Sequence

ENSEMBL: ENSMUSP00000030677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030677]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030677
AA Change: H487Q

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: H487Q

Domain	Start	End	E-Value	Type
low complexity region	98	109	N/A	INTRINSIC
Pfam:DUF4071	130	508	2.3e-150	PFAM
S_TKc	649	907	3.49e-87	SMART
low complexity region	925	940	N/A	INTRINSIC
low complexity region	947	960	N/A	INTRINSIC
low complexity region	975	990	N/A	INTRINSIC
low complexity region	1130	1146	N/A	INTRINSIC
coiled coil region	1164	1195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123612

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127681

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134895

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat1	T	C	8: 111,982,496	K232E	probably benign	Het
Apba1	T	C	19: 23,893,962	M386T	probably damaging	Het
Appl2	G	T	10: 83,608,737	F472L	possibly damaging	Het
Atxn2	T	C	5: 121,803,077	Y56H	probably damaging	Het
Cacna1c	T	C	6: 118,670,407	Y809C	probably damaging	Het
Canx	C	T	11: 50,310,867	V59I	probably benign	Het
Catsperb	T	C	12: 101,594,219	L823P	probably damaging	Het
Crb3	T	C	17: 57,065,090	S46P	probably benign	Het
Daam1	G	A	12: 71,989,827	R1058H	probably damaging	Het
Ehd1	T	A	19: 6,298,472	D493E	probably damaging	Het
Eml6	T	A	11: 29,818,907	Q746L	probably damaging	Het
Epg5	T	A	18: 77,949,072	M328K	probably benign	Het
Flt4	T	A	11: 49,624,728	S48T	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm7535	A	G	17: 17,911,674		probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Hmcn2	A	T	2: 31,350,574	T494S	probably benign	Het
Hydin	G	A	8: 110,418,506	V830I	probably benign	Het
Myh14	G	A	7: 44,634,376	P735S	probably damaging	Het
Nfkb2	T	C	19: 46,307,724		probably null	Het
Nlrp4c	T	C	7: 6,073,114	V671A	probably benign	Het
Nsrp1	A	T	11: 77,045,761	Y536*	probably null	Het
Olfr1217	G	T	2: 89,023,426	H192Q	probably benign	Het
Pak7	A	G	2: 136,116,203	S322P	probably damaging	Het
Pank2	A	G	2: 131,282,681		probably null	Het
Phf6	A	T	X: 52,942,648	I272F	probably damaging	Het
Plxna2	T	C	1: 194,797,748	L1409P	probably damaging	Het
Polr2a	A	G	11: 69,742,685		probably null	Het
Pp2d1	C	A	17: 53,515,454	V195L	probably benign	Het
Psma1	C	T	7: 114,264,938	E227K	unknown	Het
Ptger1	C	T	8: 83,668,728	T278I	probably benign	Het
Slc20a2	C	A	8: 22,560,516	S250R	probably benign	Het
Slc27a2	A	G	2: 126,567,752	T285A	probably damaging	Het
Slc47a2	T	C	11: 61,313,671	T285A	probably benign	Het
Slf1	T	A	13: 77,046,706		probably null	Het
Tiam2	A	G	17: 3,415,114	T373A	probably benign	Het
Timd2	T	A	11: 46,687,017	I96L	probably damaging	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tmem64	T	C	4: 15,266,658	I236T	possibly damaging	Het
Trpm2	T	A	10: 77,941,182	D427V	probably damaging	Het
Vax2	A	T	6: 83,737,889	Y262F	probably damaging	Het
Virma	T	C	4: 11,544,924	S1628P	probably damaging	Het
Zan	C	A	5: 137,410,306		probably benign	Het
Zbtb22	T	G	17: 33,917,965	D361E	probably damaging	Het
Zfp27	A	G	7: 29,896,111	L143P	possibly damaging	Het

Other mutations in Map3k6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Map3k6	APN	4	133243044	splice site	probably benign
IGL01060:Map3k6	APN	4	133247302	splice site	probably null
IGL01116:Map3k6	APN	4	133247128	missense	probably damaging	0.98
IGL01341:Map3k6	APN	4	133248060	missense	possibly damaging	0.67
IGL02383:Map3k6	APN	4	133246621	splice site	probably null
IGL03090:Map3k6	APN	4	133243366	missense	probably benign	0.05
IGL03096:Map3k6	APN	4	133251345	nonsense	probably null
IGL03149:Map3k6	APN	4	133249688	missense	probably damaging	1.00
R0110:Map3k6	UTSW	4	133243794	missense	probably damaging	1.00
R0142:Map3k6	UTSW	4	133250946	missense	probably benign
R0189:Map3k6	UTSW	4	133246941	missense	possibly damaging	0.46
R0368:Map3k6	UTSW	4	133252659	missense	probably benign	0.23
R0417:Map3k6	UTSW	4	133248082	nonsense	probably null
R0595:Map3k6	UTSW	4	133241263	missense	probably damaging	0.98
R0597:Map3k6	UTSW	4	133245552	missense	possibly damaging	0.46
R0699:Map3k6	UTSW	4	133248126	missense	probably damaging	1.00
R1099:Map3k6	UTSW	4	133247128	missense	probably damaging	1.00
R1113:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1308:Map3k6	UTSW	4	133245815	missense	probably damaging	1.00
R1607:Map3k6	UTSW	4	133252473	missense	probably damaging	1.00
R3734:Map3k6	UTSW	4	133248396	missense	possibly damaging	0.79
R3735:Map3k6	UTSW	4	133246372	missense	probably benign	0.21
R3743:Map3k6	UTSW	4	133245073	missense	probably benign	0.26
R4244:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4245:Map3k6	UTSW	4	133251947	missense	possibly damaging	0.65
R4465:Map3k6	UTSW	4	133246333	missense	possibly damaging	0.66
R4482:Map3k6	UTSW	4	133243399	missense	probably benign	0.00
R4827:Map3k6	UTSW	4	133248849	missense	possibly damaging	0.92
R5092:Map3k6	UTSW	4	133251743	missense	probably benign	0.00
R5110:Map3k6	UTSW	4	133247548	intron	probably benign
R5258:Map3k6	UTSW	4	133247642	missense	possibly damaging	0.81
R5369:Map3k6	UTSW	4	133247681	missense	probably damaging	0.99
R5642:Map3k6	UTSW	4	133245544	missense	probably damaging	0.99
R5648:Map3k6	UTSW	4	133243335	missense	probably benign	0.25
R6102:Map3k6	UTSW	4	133247131	critical splice donor site	probably null
R6144:Map3k6	UTSW	4	133245675	missense	probably damaging	1.00
R6476:Map3k6	UTSW	4	133250086	missense	probably damaging	0.98
R6511:Map3k6	UTSW	4	133248078	missense	probably damaging	0.98
R6522:Map3k6	UTSW	4	133250024	missense	possibly damaging	0.65
R6706:Map3k6	UTSW	4	133250939	nonsense	probably null
R6874:Map3k6	UTSW	4	133250656	missense	probably benign	0.02
R7069:Map3k6	UTSW	4	133251712	missense	probably benign	0.01
R7216:Map3k6	UTSW	4	133246900	missense	probably damaging	0.99
R7417:Map3k6	UTSW	4	133248396	missense	probably benign	0.43
R7538:Map3k6	UTSW	4	133251927	missense	probably benign
R7569:Map3k6	UTSW	4	133250077	missense	probably benign	0.04
Z1088:Map3k6	UTSW	4	133245066	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGATAGACAGTGCCCGTGTTC -3'
(R):5'- CAGGACCTTGTTTATCTCCAGC -3'

Sequencing Primer
(F):5'- CCCCTCTGTTCGTGGTATGTG -3'
(R):5'- GCACCAGTACCTGTAAGCAGTAG -3'

Posted On

2014-10-15