Incidental Mutation 'R2217:Slc47a2'
List |< first << previous [record 35 of 46] next >> last >|
ID241225
Institutional Source Beutler Lab
Gene Symbol Slc47a2
Ensembl Gene ENSMUSG00000069855
Gene Namesolute carrier family 47, member 2
Synonyms4933429E10Rik
MMRRC Submission 040219-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2217 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61301631-61342860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61313671 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000120907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093029] [ENSMUST00000134423]
Predicted Effect probably benign
Transcript: ENSMUST00000093029
AA Change: T285A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090710
Gene: ENSMUSG00000069855
AA Change: T285A

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 1.7e-35 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 4e-34 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 545 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134423
AA Change: T285A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120907
Gene: ENSMUSG00000069855
AA Change: T285A

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
Pfam:MatE 53 213 3.5e-32 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Pfam:MatE 274 435 1.7e-36 PFAM
transmembrane domain 444 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,982,496 K232E probably benign Het
Apba1 T C 19: 23,893,962 M386T probably damaging Het
Appl2 G T 10: 83,608,737 F472L possibly damaging Het
Atxn2 T C 5: 121,803,077 Y56H probably damaging Het
Cacna1c T C 6: 118,670,407 Y809C probably damaging Het
Canx C T 11: 50,310,867 V59I probably benign Het
Catsperb T C 12: 101,594,219 L823P probably damaging Het
Crb3 T C 17: 57,065,090 S46P probably benign Het
Daam1 G A 12: 71,989,827 R1058H probably damaging Het
Ehd1 T A 19: 6,298,472 D493E probably damaging Het
Eml6 T A 11: 29,818,907 Q746L probably damaging Het
Epg5 T A 18: 77,949,072 M328K probably benign Het
Flt4 T A 11: 49,624,728 S48T probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7535 A G 17: 17,911,674 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hmcn2 A T 2: 31,350,574 T494S probably benign Het
Hydin G A 8: 110,418,506 V830I probably benign Het
Map3k6 T A 4: 133,246,672 H487Q possibly damaging Het
Myh14 G A 7: 44,634,376 P735S probably damaging Het
Nfkb2 T C 19: 46,307,724 probably null Het
Nlrp4c T C 7: 6,073,114 V671A probably benign Het
Nsrp1 A T 11: 77,045,761 Y536* probably null Het
Olfr1217 G T 2: 89,023,426 H192Q probably benign Het
Pak7 A G 2: 136,116,203 S322P probably damaging Het
Pank2 A G 2: 131,282,681 probably null Het
Phf6 A T X: 52,942,648 I272F probably damaging Het
Plxna2 T C 1: 194,797,748 L1409P probably damaging Het
Polr2a A G 11: 69,742,685 probably null Het
Pp2d1 C A 17: 53,515,454 V195L probably benign Het
Psma1 C T 7: 114,264,938 E227K unknown Het
Ptger1 C T 8: 83,668,728 T278I probably benign Het
Slc20a2 C A 8: 22,560,516 S250R probably benign Het
Slc27a2 A G 2: 126,567,752 T285A probably damaging Het
Slf1 T A 13: 77,046,706 probably null Het
Tiam2 A G 17: 3,415,114 T373A probably benign Het
Timd2 T A 11: 46,687,017 I96L probably damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem64 T C 4: 15,266,658 I236T possibly damaging Het
Trpm2 T A 10: 77,941,182 D427V probably damaging Het
Vax2 A T 6: 83,737,889 Y262F probably damaging Het
Virma T C 4: 11,544,924 S1628P probably damaging Het
Zan C A 5: 137,410,306 probably benign Het
Zbtb22 T G 17: 33,917,965 D361E probably damaging Het
Zfp27 A G 7: 29,896,111 L143P possibly damaging Het
Other mutations in Slc47a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc47a2 APN 11 61302233 missense probably benign 0.16
IGL01367:Slc47a2 APN 11 61329781 missense probably benign 0.03
IGL01681:Slc47a2 APN 11 61338040 missense probably damaging 1.00
IGL01874:Slc47a2 APN 11 61312859 critical splice acceptor site probably null
IGL02049:Slc47a2 APN 11 61342539 missense probably damaging 0.98
IGL02399:Slc47a2 APN 11 61302194 unclassified probably benign
IGL02481:Slc47a2 APN 11 61336241 missense possibly damaging 0.58
IGL02880:Slc47a2 APN 11 61307540 missense probably damaging 0.97
IGL03068:Slc47a2 APN 11 61303943 missense probably damaging 1.00
IGL03136:Slc47a2 APN 11 61310765 missense probably benign 0.00
IGL03236:Slc47a2 APN 11 61313679 missense probably damaging 1.00
IGL03286:Slc47a2 APN 11 61342467 missense possibly damaging 0.57
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0047:Slc47a2 UTSW 11 61336242 missense possibly damaging 0.90
R0597:Slc47a2 UTSW 11 61309976 missense probably damaging 0.98
R0690:Slc47a2 UTSW 11 61342504 missense possibly damaging 0.62
R2042:Slc47a2 UTSW 11 61338082 missense probably benign 0.05
R2218:Slc47a2 UTSW 11 61313671 missense probably benign 0.00
R2271:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R2272:Slc47a2 UTSW 11 61328526 critical splice donor site probably null
R4067:Slc47a2 UTSW 11 61303947 missense probably benign 0.00
R4861:Slc47a2 UTSW 11 61336233 missense probably benign 0.00
R4861:Slc47a2 UTSW 11 61336233 missense probably benign 0.00
R4862:Slc47a2 UTSW 11 61313694 missense possibly damaging 0.69
R4985:Slc47a2 UTSW 11 61302233 missense probably benign
R5419:Slc47a2 UTSW 11 61307586 missense probably benign
R5593:Slc47a2 UTSW 11 61342660 missense probably benign 0.00
R7105:Slc47a2 UTSW 11 61342443 missense probably benign 0.07
R7358:Slc47a2 UTSW 11 61308873 missense possibly damaging 0.78
R7522:Slc47a2 UTSW 11 61302250 missense probably benign 0.14
Z1176:Slc47a2 UTSW 11 61325889 missense probably benign 0.28
Z1177:Slc47a2 UTSW 11 61328575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATCACAAAACACAGGCGG -3'
(R):5'- AAGCTGTGGTCTTCCCTGAC -3'

Sequencing Primer
(F):5'- TGAGAGCGATGCCAGCG -3'
(R):5'- CGTATCCTGCTGGGGAAC -3'
Posted On2014-10-15