Incidental Mutation 'R2317:Ccdc102a'
ID245524
Institutional Source Beutler Lab
Gene Symbol Ccdc102a
Ensembl Gene ENSMUSG00000063605
Gene Namecoiled-coil domain containing 102A
SynonymsLOC234582
MMRRC Submission 040312-MU
Accession Numbers

Genbank: NM_001033533; MGI: 2686927

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2317 (G1)
Quality Score173
Status Not validated
Chromosome8
Chromosomal Location94902869-94918098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94908329 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 327 (D327G)
Ref Sequence ENSEMBL: ENSMUSP00000077107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077955]
Predicted Effect probably null
Transcript: ENSMUST00000077955
AA Change: D327G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077107
Gene: ENSMUSG00000063605
AA Change: D327G

DomainStartEndE-ValueType
low complexity region 36 67 N/A INTRINSIC
low complexity region 71 87 N/A INTRINSIC
coiled coil region 101 160 N/A INTRINSIC
Pfam:Myosin_tail_1 311 508 8e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Ccdc102a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ccdc102a APN 8 94911638 unclassified probably null
IGL01921:Ccdc102a APN 8 94913391 missense probably damaging 1.00
IGL02961:Ccdc102a APN 8 94903350 missense possibly damaging 0.95
R0413:Ccdc102a UTSW 8 94903286 missense probably benign 0.23
R0423:Ccdc102a UTSW 8 94905926 splice site probably benign
R0437:Ccdc102a UTSW 8 94913426 missense probably damaging 1.00
R1468:Ccdc102a UTSW 8 94906086 missense probably benign 0.06
R1468:Ccdc102a UTSW 8 94906086 missense probably benign 0.06
R1540:Ccdc102a UTSW 8 94907713 critical splice donor site probably null
R1893:Ccdc102a UTSW 8 94913543 missense probably damaging 1.00
R4280:Ccdc102a UTSW 8 94907816 nonsense probably null
R6115:Ccdc102a UTSW 8 94903371 missense probably benign
R6331:Ccdc102a UTSW 8 94911516 missense probably benign
R6650:Ccdc102a UTSW 8 94913264 missense probably benign 0.23
R7019:Ccdc102a UTSW 8 94909803 missense probably benign 0.42
R7302:Ccdc102a UTSW 8 94913438 missense probably damaging 1.00
R7402:Ccdc102a UTSW 8 94903353 missense probably damaging 1.00
R7995:Ccdc102a UTSW 8 94907867 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGCTATAATTATGCCGGGC -3'
(R):5'- TCGAGGCACCAAGAACTCTC -3'

Sequencing Primer
(F):5'- AAAGGGGGTGCCTCCTG -3'
(R):5'- GAACTCTCAGAGGAGCCTACTC -3'
Posted On2014-10-30