Incidental Mutation 'R2317:Nodal'
ID245531
Institutional Source Beutler Lab
Gene Symbol Nodal
Ensembl Gene ENSMUSG00000037171
Gene Namenodal
SynonymsTg.413d
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2317 (G1)
Quality Score193
Status Not validated
Chromosome10
Chromosomal Location61417972-61425338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61418433 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 45 (M45T)
Ref Sequence ENSEMBL: ENSMUSP00000039653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049339]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049339
AA Change: M45T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039653
Gene: ENSMUSG00000037171
AA Change: M45T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
TGFB 254 354 2.6e-58 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which regulates early embryonic development. Homozygous knockout mice for this gene exhibit early embryonic lethality, while expression of a hypomorphic allele results in defects in anteroposterior and left-right patterning. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mutants fail to form a primitive streak, show placental defects and die at gastrulation. Hypomorphic mutants are defective in anterior-posterior, anterior-midline, and left-right body patterning, resulting in multiple organ defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Nodal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Nodal APN 10 61418397 missense probably benign 0.00
IGL02153:Nodal APN 10 61424545 missense probably damaging 1.00
R1540:Nodal UTSW 10 61422985 missense probably damaging 0.96
R1993:Nodal UTSW 10 61418334 missense probably benign 0.05
R2086:Nodal UTSW 10 61423298 missense possibly damaging 0.76
R3110:Nodal UTSW 10 61424497 missense possibly damaging 0.75
R3112:Nodal UTSW 10 61424497 missense possibly damaging 0.75
R3973:Nodal UTSW 10 61423054 missense probably benign
R5785:Nodal UTSW 10 61423677 missense probably damaging 1.00
R5967:Nodal UTSW 10 61423667 missense probably damaging 0.99
R6166:Nodal UTSW 10 61424558 missense probably damaging 1.00
R6212:Nodal UTSW 10 61423521 missense possibly damaging 0.82
R6238:Nodal UTSW 10 61423479 missense probably damaging 0.96
X0026:Nodal UTSW 10 61424560 missense probably damaging 1.00
Z1177:Nodal UTSW 10 61418375 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATAGGTTATAGGCCTCTCCGGAG -3'
(R):5'- GGAGAAACAATTAATCCCAGTCTCTG -3'

Sequencing Primer
(F):5'- CTCAGATATAAGGGACCCTGGTG -3'
(R):5'- GGACGATTCTTGATGCTCAGTCC -3'
Posted On2014-10-30