Incidental Mutation 'R2317:Neurod6'
ID245522
Institutional Source Beutler Lab
Gene Symbol Neurod6
Ensembl Gene ENSMUSG00000037984
Gene Nameneurogenic differentiation 6
SynonymsAtoh2, Nex, Math2, Nex1m, bHLHa2, Math-2
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location55677822-55681263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55678921 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 244 (Y244H)
Ref Sequence ENSEMBL: ENSMUSP00000047016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044767]
Predicted Effect probably damaging
Transcript: ENSMUST00000044767
AA Change: Y244H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047016
Gene: ENSMUSG00000037984
AA Change: Y244H

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
HLH 100 152 6.35e-17 SMART
Pfam:Neuro_bHLH 153 272 2.8e-42 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the NEUROD family of basic helix-loop-helix transcription factors. The encoded protein may be involved in the development and differentiation of the nervous system. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and exhibit an apparently normal differentiation of CNS neurons with no obvious behavioral or motor abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Neurod6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Neurod6 APN 6 55678775 nonsense probably null
R0446:Neurod6 UTSW 6 55679629 missense probably benign 0.17
R0540:Neurod6 UTSW 6 55679587 missense probably benign
R0607:Neurod6 UTSW 6 55679587 missense probably benign
R1752:Neurod6 UTSW 6 55679526 missense probably benign 0.00
R2078:Neurod6 UTSW 6 55678969 missense probably benign 0.00
R4379:Neurod6 UTSW 6 55679272 missense probably damaging 0.99
R4807:Neurod6 UTSW 6 55678655 missense probably damaging 1.00
R5952:Neurod6 UTSW 6 55679017 missense probably damaging 0.99
R6116:Neurod6 UTSW 6 55678791 missense probably damaging 1.00
R7391:Neurod6 UTSW 6 55679631 missense probably damaging 0.99
R7418:Neurod6 UTSW 6 55679298 missense probably damaging 1.00
Z1088:Neurod6 UTSW 6 55679362 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGTAAGGGAAGTGGCTGTC -3'
(R):5'- TCAACGCCAGAAGTTTCCTG -3'

Sequencing Primer
(F):5'- TGAACATGGCACCCTGC -3'
(R):5'- ACGCCAGAAGTTTCCTGATGGG -3'
Posted On2014-10-30