Incidental Mutation 'R2317:Zfp959'
ID245542
Institutional Source Beutler Lab
Gene Symbol Zfp959
Ensembl Gene ENSMUSG00000003198
Gene Namezinc finger protein 959
SynonymsBC011426
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55892093-55898928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55897326 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 121 (D121G)
Ref Sequence ENSEMBL: ENSMUSP00000053979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054780] [ENSMUST00000224379]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054780
AA Change: D121G

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053979
Gene: ENSMUSG00000003198
AA Change: D121G

DomainStartEndE-ValueType
KRAB 4 66 5.28e-14 SMART
ZnF_C2H2 155 177 2.57e2 SMART
ZnF_C2H2 287 309 1.1e-2 SMART
ZnF_C2H2 315 337 4.17e-3 SMART
ZnF_C2H2 343 365 1.47e-3 SMART
ZnF_C2H2 371 393 5.14e-3 SMART
ZnF_C2H2 399 421 1.82e-3 SMART
ZnF_C2H2 427 449 1.98e-4 SMART
ZnF_C2H2 455 477 2.57e-3 SMART
ZnF_C2H2 483 505 7.26e-3 SMART
ZnF_C2H2 511 533 1.72e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224294
Predicted Effect probably benign
Transcript: ENSMUST00000224379
AA Change: D118G

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Other mutations in Zfp959
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfp959 APN 17 55897565 missense possibly damaging 0.91
IGL02731:Zfp959 APN 17 55895956 splice site probably benign
IGL03206:Zfp959 APN 17 55897613 missense possibly damaging 0.78
R0141:Zfp959 UTSW 17 55898139 missense probably benign 0.41
R0347:Zfp959 UTSW 17 55897180 nonsense probably null
R0522:Zfp959 UTSW 17 55896201 missense probably null 1.00
R1692:Zfp959 UTSW 17 55898299 missense probably damaging 0.99
R1771:Zfp959 UTSW 17 55897677 unclassified probably null
R1891:Zfp959 UTSW 17 55897604 missense probably damaging 1.00
R1945:Zfp959 UTSW 17 55897231 nonsense probably null
R1959:Zfp959 UTSW 17 55897404 missense probably damaging 0.98
R4726:Zfp959 UTSW 17 55898260 unclassified probably null
R4869:Zfp959 UTSW 17 55897228 missense possibly damaging 0.95
R5436:Zfp959 UTSW 17 55897626 missense probably benign
R6235:Zfp959 UTSW 17 55897427 missense probably damaging 1.00
R6365:Zfp959 UTSW 17 55897785 missense probably damaging 1.00
R6391:Zfp959 UTSW 17 55895854 missense probably damaging 1.00
R6417:Zfp959 UTSW 17 55898094 missense probably damaging 1.00
R6420:Zfp959 UTSW 17 55898094 missense probably damaging 1.00
R7114:Zfp959 UTSW 17 55898501 missense possibly damaging 0.94
R7380:Zfp959 UTSW 17 55898551 missense possibly damaging 0.94
R7437:Zfp959 UTSW 17 55898334 missense probably damaging 1.00
R7568:Zfp959 UTSW 17 55897886 missense probably benign 0.01
Z1088:Zfp959 UTSW 17 55898135 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAATCCTCCATAGTGAAGCTAGTGT -3'
(R):5'- TGAAGATACCTGGGATGGGTTA -3'

Sequencing Primer
(F):5'- GTTGTAGTGGAGAAACTTGAATCCC -3'
(R):5'- GGTTAAGCTTTTACTACTTGGCTCAC -3'
Posted On2014-10-30