Incidental Mutation 'R2331:Olfr1216'
ID245862
Institutional Source Beutler Lab
Gene Symbol Olfr1216
Ensembl Gene ENSMUSG00000075107
Gene Nameolfactory receptor 1216
SynonymsGA_x6K02T2Q125-50494588-50493653, MOR233-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2331 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89007563-89018340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89013921 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 48 (I48V)
Ref Sequence ENSEMBL: ENSMUSP00000149441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]
Predicted Effect probably benign
Transcript: ENSMUST00000099800
AA Change: I48V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: I48V

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.8e-46 PFAM
Pfam:7tm_1 39 286 4.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216000
AA Change: I48V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000217000
AA Change: I48V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218738
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C T 1: 38,204,890 probably null Het
Cadps A G 14: 12,603,692 I376T probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gm10295 A C 7: 71,350,689 S48A unknown Het
Gstcd A G 3: 132,998,880 C538R probably damaging Het
Hcn3 A T 3: 89,148,090 S617T probably benign Het
Hectd4 A G 5: 121,320,026 I752V probably benign Het
Itgb7 G T 15: 102,223,548 T200K probably damaging Het
Lcn11 C A 2: 25,780,176 T177K possibly damaging Het
Lsm14a A G 7: 34,357,490 V241A probably benign Het
Magi1 T C 6: 93,685,562 K1075E probably damaging Het
Olfr1426 C A 19: 12,088,158 L211F probably benign Het
P4hb T C 11: 120,568,280 N129S probably benign Het
Piezo1 C T 8: 122,487,266 probably null Het
Ppp3ca T C 3: 136,797,819 M51T probably benign Het
Sema6d T C 2: 124,658,063 V353A probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sh3rf2 T C 18: 42,053,863 F16L probably benign Het
Sparcl1 A G 5: 104,085,794 L563P probably damaging Het
Stra6l T C 4: 45,858,224 probably null Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Trpv5 A G 6: 41,659,968 S399P probably damaging Het
Uggt2 A T 14: 119,026,599 F1006L possibly damaging Het
Uhrf1 C A 17: 56,310,671 probably null Het
Wdr72 A G 9: 74,148,326 Y279C probably damaging Het
Other mutations in Olfr1216
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Olfr1216 APN 2 89013924 missense probably benign 0.22
IGL00895:Olfr1216 APN 2 89013609 missense probably benign 0.13
IGL01634:Olfr1216 APN 2 89013444 missense probably damaging 0.99
IGL01844:Olfr1216 APN 2 89013470 missense possibly damaging 0.95
IGL02036:Olfr1216 APN 2 89013479 missense probably benign 0.00
IGL02102:Olfr1216 APN 2 89013126 utr 3 prime probably benign
IGL02194:Olfr1216 APN 2 89013887 missense probably damaging 1.00
IGL02483:Olfr1216 APN 2 89013203 missense probably damaging 1.00
IGL02745:Olfr1216 APN 2 89013888 missense probably damaging 1.00
IGL02829:Olfr1216 APN 2 89013677 missense probably damaging 1.00
IGL03113:Olfr1216 APN 2 89014035 missense probably damaging 1.00
IGL03324:Olfr1216 APN 2 89013559 nonsense probably null
R0102:Olfr1216 UTSW 2 89013671 missense probably damaging 1.00
R0304:Olfr1216 UTSW 2 89013288 missense probably damaging 1.00
R1184:Olfr1216 UTSW 2 89013713 missense probably damaging 0.99
R1484:Olfr1216 UTSW 2 89013369 nonsense probably null
R1560:Olfr1216 UTSW 2 89013206 missense probably damaging 1.00
R1823:Olfr1216 UTSW 2 89013378 missense probably benign 0.02
R1911:Olfr1216 UTSW 2 89013221 missense probably damaging 1.00
R2245:Olfr1216 UTSW 2 89013149 missense probably benign
R3859:Olfr1216 UTSW 2 89014061 start codon destroyed probably null 1.00
R4579:Olfr1216 UTSW 2 89013144 missense probably benign
R5022:Olfr1216 UTSW 2 89014043 missense probably damaging 0.96
R5353:Olfr1216 UTSW 2 89013755 missense probably benign 0.00
R5894:Olfr1216 UTSW 2 89014055 missense probably damaging 1.00
R6240:Olfr1216 UTSW 2 89013626 missense probably benign 0.03
R7101:Olfr1216 UTSW 2 89013980 missense possibly damaging 0.90
R7652:Olfr1216 UTSW 2 89013549 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACAATCATTTCTGCTCCTGAG -3'
(R):5'- CTCCTCAATGCAAATGTATCTATTCGC -3'

Sequencing Primer
(F):5'- TCTGCTCCTGAGAAGAAATGGACTG -3'
(R):5'- TGCAAATGTATCTATTCGCATAAGG -3'
Posted On2014-10-30