Mutagenetix > Incidental Mutation

Incidental Mutation 'R5894:Olfr1216'

457350

Institutional Source

Beutler Lab

Gene Symbol

Olfr1216

Ensembl Gene

ENSMUSG00000075107

Gene Name

olfactory receptor 1216

Synonyms

GA_x6K02T2Q125-50494588-50493653, MOR233-9

MMRRC Submission

043238-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R5894 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89007563-89018340 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89014055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 3 (N3I)

Ref Sequence

ENSEMBL: ENSMUSP00000149441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099800] [ENSMUST00000216000] [ENSMUST00000217000]

AlphaFold

Q7TR05

Predicted Effect

probably damaging
Transcript: ENSMUST00000099800
AA Change: N3I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097388
Gene: ENSMUSG00000075107
AA Change: N3I

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	303	1.8e-46	PFAM
Pfam:7tm_1	39	286	4.2e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000216000
AA Change: N3I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217000
AA Change: N3I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218738

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503B20Rik	T	A	3: 146,650,925	E76V	probably benign	Het
Adcy2	A	T	13: 68,625,852	I1024N	probably damaging	Het
Agr2	A	C	12: 35,995,510		probably benign	Het
Alpk2	T	A	18: 65,281,072	H1991L	probably damaging	Het
Amotl2	T	A	9: 102,725,172	M448K	possibly damaging	Het
Ankhd1	T	A	18: 36,647,524	F1876L	probably damaging	Het
Arl14	T	C	3: 69,222,676	V52A	probably benign	Het
Arntl2	A	G	6: 146,823,234	T409A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,107,566		probably null	Het
Bpifb4	G	A	2: 153,940,932	R19H	possibly damaging	Het
Ccdc144b	C	T	3: 36,019,975	E342K	possibly damaging	Het
Cdh9	T	A	15: 16,832,100	L358I	possibly damaging	Het
Ces2h	T	G	8: 105,019,026	I460M	probably benign	Het
Cog2	T	C	8: 124,545,267	Y507H	probably benign	Het
Crlf3	T	A	11: 80,057,852	R256W	probably damaging	Het
Csdc2	T	A	15: 81,948,680	F96I	probably damaging	Het
Csk	A	C	9: 57,628,675	I264S	probably damaging	Het
Cyp2c29	G	C	19: 39,330,389	A438P	possibly damaging	Het
Ddx43	G	A	9: 78,416,734	G449D	probably damaging	Het
Fbxw18	G	T	9: 109,700,167	A106E	possibly damaging	Het
Fchsd2	C	T	7: 101,191,752	T156I	probably benign	Het
Frs2	T	A	10: 117,081,106		probably benign	Het
Grid2ip	A	T	5: 143,388,911	T922S	probably damaging	Het
Grm1	A	G	10: 11,080,255	L95P	probably damaging	Het
Ift140	T	C	17: 25,033,919	V348A	possibly damaging	Het
Insr	A	G	8: 3,174,869	S200P	possibly damaging	Het
Ints12	A	T	3: 133,098,558	D102V	probably damaging	Het
Kank1	A	G	19: 25,424,200	D1057G	probably damaging	Het
Kng1	T	A	16: 23,073,363	D225E	probably benign	Het
Lama1	A	T	17: 67,779,047		probably null	Het
Lpin2	A	G	17: 71,246,934	D882G	probably benign	Het
Lrp1b	A	T	2: 41,498,221	F464Y	probably benign	Het
Musk	G	A	4: 58,373,583	C836Y	probably damaging	Het
Mx1	C	T	16: 97,454,206	D216N	probably damaging	Het
Ndrg3	A	T	2: 156,928,778	N350K	probably benign	Het
Oas3	G	A	5: 120,756,954	P990L	probably damaging	Het
Olfr1255	T	C	2: 89,817,213	S296P	possibly damaging	Het
Olfr791	A	G	10: 129,526,488	D87G	probably damaging	Het
Otoa	T	C	7: 121,121,869	L369P	probably damaging	Het
Plcg2	A	G	8: 117,504,349	T57A	probably damaging	Het
Prune2	A	T	19: 17,121,391	T1420S	possibly damaging	Het
Ptpdc1	A	G	13: 48,590,322	F201S	probably damaging	Het
Rnf214	A	G	9: 45,866,618	V630A	probably damaging	Het
Rxrb	T	A	17: 34,035,744	I181N	probably damaging	Het
Scrib	T	C	15: 76,067,732	N69S	probably damaging	Het
Scyl2	A	G	10: 89,640,819	S815P	probably benign	Het
Sgcd	A	G	11: 47,355,201	V58A	probably damaging	Het
Slc13a3	C	T	2: 165,424,623	V374I	probably benign	Het
Slc22a4	A	T	11: 53,997,515	I229N	probably benign	Het
Slc44a5	A	G	3: 154,256,573	Y381C	probably damaging	Het
Sohlh1	A	G	2: 25,844,667	S205P	possibly damaging	Het
Spata20	T	C	11: 94,483,618	M308V	probably damaging	Het
Stag3	T	G	5: 138,298,838	I550R	probably damaging	Het
Tac2	A	G	10: 127,726,102	E25G	possibly damaging	Het
Tars2	T	C	3: 95,747,652		probably null	Het
Tefm	G	A	11: 80,140,231	R60C	probably damaging	Het
Trem3	T	C	17: 48,258,455	V179A	probably benign	Het
Trim37	G	T	11: 87,201,440	D692Y	probably damaging	Het
Trpc4ap	T	C	2: 155,666,213	T173A	probably benign	Het
Unc13c	C	T	9: 73,693,204		probably null	Het
Usp18	A	G	6: 121,261,497	K201R	probably benign	Het
Usp35	T	A	7: 97,313,077	Y524F	probably damaging	Het
Usp53	A	G	3: 122,959,085	F208L	probably damaging	Het
Vmn1r80	A	T	7: 12,193,727	I255F	probably damaging	Het
Vstm2a	A	T	11: 16,261,483	I98F	probably benign	Het
Wdfy4	T	A	14: 33,133,360	I766F	possibly damaging	Het
Wdr17	T	A	8: 54,696,300	Y55F	probably damaging	Het
Xpot	T	C	10: 121,613,646	K172R	probably damaging	Het

Other mutations in Olfr1216

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Olfr1216	APN	2	89013924	missense	probably benign	0.22
IGL00895:Olfr1216	APN	2	89013609	missense	probably benign	0.13
IGL01634:Olfr1216	APN	2	89013444	missense	probably damaging	0.99
IGL01844:Olfr1216	APN	2	89013470	missense	possibly damaging	0.95
IGL02036:Olfr1216	APN	2	89013479	missense	probably benign	0.00
IGL02102:Olfr1216	APN	2	89013126	utr 3 prime	probably benign
IGL02194:Olfr1216	APN	2	89013887	missense	probably damaging	1.00
IGL02483:Olfr1216	APN	2	89013203	missense	probably damaging	1.00
IGL02745:Olfr1216	APN	2	89013888	missense	probably damaging	1.00
IGL02829:Olfr1216	APN	2	89013677	missense	probably damaging	1.00
IGL03113:Olfr1216	APN	2	89014035	missense	probably damaging	1.00
IGL03324:Olfr1216	APN	2	89013559	nonsense	probably null
R0102:Olfr1216	UTSW	2	89013671	missense	probably damaging	1.00
R0304:Olfr1216	UTSW	2	89013288	missense	probably damaging	1.00
R1184:Olfr1216	UTSW	2	89013713	missense	probably damaging	0.99
R1484:Olfr1216	UTSW	2	89013369	nonsense	probably null
R1560:Olfr1216	UTSW	2	89013206	missense	probably damaging	1.00
R1823:Olfr1216	UTSW	2	89013378	missense	probably benign	0.02
R1911:Olfr1216	UTSW	2	89013221	missense	probably damaging	1.00
R2245:Olfr1216	UTSW	2	89013149	missense	probably benign
R2331:Olfr1216	UTSW	2	89013921	missense	probably benign
R3859:Olfr1216	UTSW	2	89014061	start codon destroyed	probably null	1.00
R4579:Olfr1216	UTSW	2	89013144	missense	probably benign
R5022:Olfr1216	UTSW	2	89014043	missense	probably damaging	0.96
R5353:Olfr1216	UTSW	2	89013755	missense	probably benign	0.00
R6240:Olfr1216	UTSW	2	89013626	missense	probably benign	0.03
R7101:Olfr1216	UTSW	2	89013980	missense	possibly damaging	0.90
R7652:Olfr1216	UTSW	2	89013549	missense	probably benign	0.01
R8243:Olfr1216	UTSW	2	89013707	missense	probably benign	0.39
R8752:Olfr1216	UTSW	2	89013887	missense	probably damaging	1.00
R9062:Olfr1216	UTSW	2	89013204	missense	probably damaging	1.00
R9472:Olfr1216	UTSW	2	89013173	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CAGCCAAAGGAGATGGTCTTC -3'
(R):5'- TCCACTCATAGAGGTGGATGTG -3'

Sequencing Primer
(F):5'- ACCATCTTGGGTGTAACAGTAG -3'
(R):5'- CATAGAGGTGGATGTGTTCATAATC -3'

Posted On

2017-02-15