Incidental Mutation 'R2347:Rest'
ID 246003
Institutional Source Beutler Lab
Gene Symbol Rest
Ensembl Gene ENSMUSG00000029249
Gene Name RE1-silencing transcription factor
Synonyms NRSF, 2610008J04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2347 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 77265491-77286432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77268593 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 218 (Y218C)
Ref Sequence ENSEMBL: ENSMUSP00000109076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080359] [ENSMUST00000113449]
AlphaFold Q8VIG1
Predicted Effect probably damaging
Transcript: ENSMUST00000080359
AA Change: Y218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079231
Gene: ENSMUSG00000029249
AA Change: Y218C

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113449
AA Change: Y218C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109076
Gene: ENSMUSG00000029249
AA Change: Y218C

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175320
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted mutation of this gene results in embryonic lethality preceded by growth retardation and abnormal cellular organization in several tissues, including the hindbrain and somites. Mice with conditional deletions exhibit increased apoptosis in affected cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ces1a C T 8: 93,025,319 V396M probably benign Het
Ddx6 A G 9: 44,607,591 K67E probably benign Het
Fut2 T C 7: 45,650,328 D340G probably damaging Het
Gm128 A G 3: 95,240,930 Y18H probably benign Het
Gon4l A G 3: 88,863,517 D502G probably damaging Het
Lman2 T A 13: 55,352,999 N129I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1263 G T 2: 90,015,614 R228L possibly damaging Het
Olfr527 T A 7: 140,336,147 M95K probably damaging Het
Olfr935 A T 9: 38,994,509 *309K probably null Het
Pappa2 C A 1: 158,765,043 C1588F probably damaging Het
Piwil2 T C 14: 70,408,917 D390G probably damaging Het
Other mutations in Rest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Rest APN 5 77275288 missense probably damaging 1.00
pace UTSW 5 77275243 missense possibly damaging 0.94
ruhe UTSW 5 77268362 missense possibly damaging 0.71
R0027:Rest UTSW 5 77282551 missense probably benign
R0479:Rest UTSW 5 77282751 missense probably damaging 0.99
R0526:Rest UTSW 5 77281027 missense probably damaging 0.98
R1865:Rest UTSW 5 77280898 missense probably damaging 1.00
R1869:Rest UTSW 5 77268362 missense possibly damaging 0.71
R1870:Rest UTSW 5 77268362 missense possibly damaging 0.71
R2089:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2366:Rest UTSW 5 77268187 missense probably benign 0.00
R3609:Rest UTSW 5 77282800 missense probably benign 0.06
R4249:Rest UTSW 5 77282112 missense probably benign
R4471:Rest UTSW 5 77281180 missense probably benign 0.01
R4472:Rest UTSW 5 77281180 missense probably benign 0.01
R4685:Rest UTSW 5 77275243 missense possibly damaging 0.94
R5175:Rest UTSW 5 77268372 missense probably damaging 1.00
R5566:Rest UTSW 5 77282326 missense probably benign 0.00
R5686:Rest UTSW 5 77281726 missense probably benign 0.01
R5976:Rest UTSW 5 77268272 missense probably benign 0.07
R6052:Rest UTSW 5 77281180 missense probably benign 0.34
R6076:Rest UTSW 5 77282974 missense unknown
R6249:Rest UTSW 5 77281224 missense probably benign 0.01
R6448:Rest UTSW 5 77281471 missense possibly damaging 0.75
R6681:Rest UTSW 5 77280997 missense probably damaging 1.00
R6974:Rest UTSW 5 77268199 missense probably damaging 1.00
R7185:Rest UTSW 5 77282484 missense probably benign
R7216:Rest UTSW 5 77282608 missense probably benign 0.04
R7355:Rest UTSW 5 77268028 missense probably benign 0.23
R7360:Rest UTSW 5 77281129 missense probably benign 0.36
R7705:Rest UTSW 5 77268272 missense probably damaging 1.00
R8052:Rest UTSW 5 77268324 missense probably benign 0.04
R8220:Rest UTSW 5 77282478 missense probably benign
R8441:Rest UTSW 5 77281919 missense possibly damaging 0.95
R8699:Rest UTSW 5 77281542 missense probably benign 0.04
R8879:Rest UTSW 5 77282511 missense probably benign 0.00
R8940:Rest UTSW 5 77282868 missense possibly damaging 0.91
R8961:Rest UTSW 5 77268635 missense probably damaging 1.00
R9165:Rest UTSW 5 77281804 small deletion probably benign
R9167:Rest UTSW 5 77281804 small deletion probably benign
R9168:Rest UTSW 5 77281804 small deletion probably benign
R9168:Rest UTSW 5 77281843 small deletion probably benign
R9170:Rest UTSW 5 77281804 small deletion probably benign
R9377:Rest UTSW 5 77268281 missense possibly damaging 0.47
Z1177:Rest UTSW 5 77280909 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CAGTACGAAGCCGAATCTGAAG -3'
(R):5'- TGAGTTCGCACGTGCTGAAC -3'

Sequencing Primer
(F):5'- CCGAATCTGAAGAGCAGTTTGTG -3'
(R):5'- CTGAGAAGTAGTTGCACTTGC -3'
Posted On 2014-10-30