Incidental Mutation 'R8699:Rest'
ID 668922
Institutional Source Beutler Lab
Gene Symbol Rest
Ensembl Gene ENSMUSG00000029249
Gene Name RE1-silencing transcription factor
Synonyms NRSF, 2610008J04Rik
MMRRC Submission 068553-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 77265491-77286432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77281542 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 603 (G603R)
Ref Sequence ENSEMBL: ENSMUSP00000079231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080359] [ENSMUST00000113449]
AlphaFold Q8VIG1
Predicted Effect probably benign
Transcript: ENSMUST00000080359
AA Change: G603R

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079231
Gene: ENSMUSG00000029249
AA Change: G603R

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113449
AA Change: G603R

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109076
Gene: ENSMUSG00000029249
AA Change: G603R

DomainStartEndE-ValueType
low complexity region 85 95 N/A INTRINSIC
ZnF_C2H2 154 176 1.53e-1 SMART
ZnF_C2H2 211 233 4.23e0 SMART
ZnF_C2H2 243 265 2.53e-2 SMART
ZnF_C2H2 271 293 8.34e-3 SMART
ZnF_C2H2 299 321 2.12e-4 SMART
ZnF_C2H2 327 350 1.18e-2 SMART
ZnF_C2H2 356 378 1.03e-2 SMART
ZnF_C2H2 384 407 2.53e-2 SMART
low complexity region 419 427 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
low complexity region 492 505 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 681 715 N/A INTRINSIC
low complexity region 725 744 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 843 851 N/A INTRINSIC
low complexity region 880 895 N/A INTRINSIC
ZnF_C2H2 1036 1058 2.2e-2 SMART
coiled coil region 1060 1082 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted mutation of this gene results in embryonic lethality preceded by growth retardation and abnormal cellular organization in several tissues, including the hindbrain and somites. Mice with conditional deletions exhibit increased apoptosis in affected cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik T C 16: 90,931,057 K82E probably benign Het
4933430I17Rik T C 4: 62,532,278 W30R probably damaging Het
Abca3 A G 17: 24,408,225 D1555G probably benign Het
Anapc1 T C 2: 128,641,453 T1241A probably damaging Het
Ano5 G A 7: 51,593,771 V881I probably benign Het
Appl1 G A 14: 26,940,255 S490L probably benign Het
Asxl3 A G 18: 22,434,607 T81A probably benign Het
Bclaf1 T C 10: 20,333,438 S754P possibly damaging Het
Bicra G T 7: 15,989,188 Q135K probably benign Het
Cad T C 5: 31,076,261 V1951A possibly damaging Het
Cadm3 T A 1: 173,341,116 Y295F probably damaging Het
Ccnt1 A G 15: 98,565,114 I59T probably damaging Het
Ccr6 C T 17: 8,256,566 T201M probably benign Het
Cd5 A G 19: 10,725,192 F209S possibly damaging Het
Cep126 A C 9: 8,087,361 D1017E probably damaging Het
Cntnap4 A T 8: 112,757,596 D427V probably damaging Het
Col4a4 T A 1: 82,455,734 N1496I unknown Het
Crybg3 A G 16: 59,554,928 Y274H probably damaging Het
Cubn C A 2: 13,383,959 S1479I probably damaging Het
Diras2 A T 13: 52,508,107 C55S probably damaging Het
Dleu7 G A 14: 62,292,830 R41C probably benign Het
Exo5 A G 4: 120,921,996 I224T probably damaging Het
Fcho1 T C 8: 71,709,633 I774V possibly damaging Het
Gclm T G 3: 122,266,323 S251A possibly damaging Het
Gm11639 A G 11: 104,781,246 T1464A probably benign Het
Gm13889 T C 2: 93,956,982 Q49R unknown Het
Gm35315 T A 5: 110,080,526 H18L probably benign Het
Gm9949 G A 18: 62,183,972 G65R unknown Het
Gpr153 C T 4: 152,279,101 probably benign Het
Gria4 C A 9: 4,424,347 K839N probably damaging Het
Gria4 T G 9: 4,424,351 Y838S probably damaging Het
Hrh3 A G 2: 180,101,356 W160R probably damaging Het
Htr4 G A 18: 62,437,692 A273T probably damaging Het
Lig3 G T 11: 82,794,550 C599F probably damaging Het
Lrp1b A T 2: 41,282,195 V1594E Het
Map3k10 A T 7: 27,668,355 V286D probably damaging Het
Map4k4 T A 1: 39,976,750 V117E unknown Het
Mdga1 C T 17: 29,842,374 V548M possibly damaging Het
Mms22l A T 4: 24,507,363 L248F possibly damaging Het
Ncaph T C 2: 127,121,176 D379G possibly damaging Het
Neb A G 2: 52,147,234 V7064A probably benign Het
Neb G A 2: 52,212,551 T4570M probably benign Het
Npy5r G T 8: 66,681,622 T173K probably damaging Het
Olfr1002 A T 2: 85,647,986 C112S possibly damaging Het
Olfr1037 A T 2: 86,085,174 I201N probably damaging Het
Olfr1442 A G 19: 12,674,882 M226V probably benign Het
Olfr1447 A T 19: 12,901,464 F105L possibly damaging Het
Olfr622 A T 7: 103,639,615 I175N probably damaging Het
Oxsm A G 14: 16,242,631 I46T possibly damaging Het
Pcdha1 A T 18: 36,931,023 I247F probably benign Het
Pcdhgb6 A T 18: 37,742,922 I228L probably benign Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Ppp1r9a A G 6: 5,115,474 S866G probably benign Het
Ppp6r3 T A 19: 3,496,587 S304C probably damaging Het
Pramef6 A T 4: 143,897,192 N137K probably benign Het
Ptprd A T 4: 76,041,392 F279I probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs17 A T 10: 5,918,194 L9M probably benign Het
Rtp1 A G 16: 23,431,383 Y166C probably damaging Het
Sec24b C A 3: 130,005,004 R572I probably damaging Het
Setd1a G T 7: 127,786,602 R827L possibly damaging Het
Sh3tc1 T C 5: 35,701,891 Y1091C probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stat4 T A 1: 52,071,937 M181K probably benign Het
Stk16 A G 1: 75,212,038 E67G probably benign Het
Supv3l1 A G 10: 62,432,455 V537A possibly damaging Het
Tmc8 A G 11: 117,783,535 E101G possibly damaging Het
Tmem106a A T 11: 101,582,294 probably benign Het
Tpr T A 1: 150,418,021 I922N probably damaging Het
Uaca G T 9: 60,871,065 L911F probably damaging Het
Ubn1 A T 16: 5,063,703 I200L possibly damaging Het
Ush2a A G 1: 188,911,377 D4312G probably damaging Het
Virma A T 4: 11,528,678 Y1255F probably benign Het
Vmn1r170 C T 7: 23,606,655 Q161* probably null Het
Vmn1r175 G T 7: 23,808,809 A131D probably benign Het
Vmn1r52 T A 6: 90,178,760 N15K probably benign Het
Wdr46 T A 17: 33,948,852 I513N probably damaging Het
Wdr60 T C 12: 116,207,701 T972A probably benign Het
Zfp788 A G 7: 41,648,416 N159D probably benign Het
Other mutations in Rest
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02339:Rest APN 5 77275288 missense probably damaging 1.00
pace UTSW 5 77275243 missense possibly damaging 0.94
ruhe UTSW 5 77268362 missense possibly damaging 0.71
R0027:Rest UTSW 5 77282551 missense probably benign
R0479:Rest UTSW 5 77282751 missense probably damaging 0.99
R0526:Rest UTSW 5 77281027 missense probably damaging 0.98
R1865:Rest UTSW 5 77280898 missense probably damaging 1.00
R1869:Rest UTSW 5 77268362 missense possibly damaging 0.71
R1870:Rest UTSW 5 77268362 missense possibly damaging 0.71
R2089:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2091:Rest UTSW 5 77281279 missense possibly damaging 0.92
R2347:Rest UTSW 5 77268593 missense probably damaging 1.00
R2366:Rest UTSW 5 77268187 missense probably benign 0.00
R3609:Rest UTSW 5 77282800 missense probably benign 0.06
R4249:Rest UTSW 5 77282112 missense probably benign
R4471:Rest UTSW 5 77281180 missense probably benign 0.01
R4472:Rest UTSW 5 77281180 missense probably benign 0.01
R4685:Rest UTSW 5 77275243 missense possibly damaging 0.94
R5175:Rest UTSW 5 77268372 missense probably damaging 1.00
R5566:Rest UTSW 5 77282326 missense probably benign 0.00
R5686:Rest UTSW 5 77281726 missense probably benign 0.01
R5976:Rest UTSW 5 77268272 missense probably benign 0.07
R6052:Rest UTSW 5 77281180 missense probably benign 0.34
R6076:Rest UTSW 5 77282974 missense unknown
R6249:Rest UTSW 5 77281224 missense probably benign 0.01
R6448:Rest UTSW 5 77281471 missense possibly damaging 0.75
R6681:Rest UTSW 5 77280997 missense probably damaging 1.00
R6974:Rest UTSW 5 77268199 missense probably damaging 1.00
R7185:Rest UTSW 5 77282484 missense probably benign
R7216:Rest UTSW 5 77282608 missense probably benign 0.04
R7355:Rest UTSW 5 77268028 missense probably benign 0.23
R7360:Rest UTSW 5 77281129 missense probably benign 0.36
R7705:Rest UTSW 5 77268272 missense probably damaging 1.00
R8052:Rest UTSW 5 77268324 missense probably benign 0.04
R8220:Rest UTSW 5 77282478 missense probably benign
R8441:Rest UTSW 5 77281919 missense possibly damaging 0.95
R8879:Rest UTSW 5 77282511 missense probably benign 0.00
R8940:Rest UTSW 5 77282868 missense possibly damaging 0.91
R8961:Rest UTSW 5 77268635 missense probably damaging 1.00
R9165:Rest UTSW 5 77281804 small deletion probably benign
R9167:Rest UTSW 5 77281804 small deletion probably benign
R9168:Rest UTSW 5 77281804 small deletion probably benign
R9170:Rest UTSW 5 77281804 small deletion probably benign
R9377:Rest UTSW 5 77268281 missense possibly damaging 0.47
R9476:Rest UTSW 5 77268251 missense probably damaging 0.99
R9566:Rest UTSW 5 77268430 nonsense probably null
R9596:Rest UTSW 5 77275294 missense probably damaging 1.00
Z1177:Rest UTSW 5 77280909 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGTAACTACCAGGACTCGGAAG -3'
(R):5'- TCCATTTGAGCAGGCTCCAC -3'

Sequencing Primer
(F):5'- TCCGAAGAGCCTGTGAACG -3'
(R):5'- CGGAGGTGGCCCTGTTAG -3'
Posted On 2021-04-30