Incidental Mutation 'R2339:Jakmip1'
List |< first << previous [record 12 of 30] next >> last >|
ID246668
Institutional Source Beutler Lab
Gene Symbol Jakmip1
Ensembl Gene ENSMUSG00000113373
Gene Name
SynonymsGababrbp, C330021K24Rik, Marlin-1, 5830437M04Rik
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R2339 (G1)
Quality Score189
Status Validated
Chromosome5
Chromosomal Location37113784-37117473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37091199 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 68 (Y68H)
Ref Sequence ENSEMBL: ENSMUSP00000133767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043794] [ENSMUST00000121010] [ENSMUST00000137019] [ENSMUST00000172917] [ENSMUST00000173836] [ENSMUST00000174097] [ENSMUST00000174629] [ENSMUST00000232332]
Predicted Effect probably benign
Transcript: ENSMUST00000043794
AA Change: Y68H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038504
Gene: ENSMUSG00000063646
AA Change: Y68H

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
low complexity region 467 487 N/A INTRINSIC
coiled coil region 515 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121010
AA Change: Y68H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113624
Gene: ENSMUSG00000063646
AA Change: Y68H

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
Pfam:JAKMIP_CC3 415 612 3.3e-85 PFAM
coiled coil region 678 819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137019
AA Change: Y68H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000122584
Gene: ENSMUSG00000063646
AA Change: Y68H

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 330 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158082
Predicted Effect probably benign
Transcript: ENSMUST00000172917
AA Change: Y68H

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133913
Gene: ENSMUSG00000063646
AA Change: Y68H

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173836
AA Change: Y68H

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133767
Gene: ENSMUSG00000063646
AA Change: Y68H

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
low complexity region 131 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174097
AA Change: Y68H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133770
Gene: ENSMUSG00000063646
AA Change: Y68H

DomainStartEndE-ValueType
coiled coil region 13 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174629
SMART Domains Protein: ENSMUSP00000134288
Gene: ENSMUSG00000063646

DomainStartEndE-ValueType
coiled coil region 13 52 N/A INTRINSIC
coiled coil region 119 212 N/A INTRINSIC
low complexity region 282 302 N/A INTRINSIC
coiled coil region 330 422 N/A INTRINSIC
coiled coil region 493 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201223
Predicted Effect probably benign
Transcript: ENSMUST00000232332
AA Change: Y68H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0726 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in social deficits, stereotyped activity, abnormal postnatal vocalizations, reduced anxiety/increased impulsivity and glutamatergic NMDAR signaling deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Jakmip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Jakmip1 APN 5 37085406 nonsense probably null
IGL01350:Jakmip1 APN 5 37085431 missense probably benign 0.01
IGL01613:Jakmip1 APN 5 37100768 missense probably damaging 1.00
IGL01875:Jakmip1 APN 5 37120980 missense probably damaging 0.99
IGL02006:Jakmip1 APN 5 37120987 missense probably damaging 0.99
IGL02225:Jakmip1 APN 5 37104856 missense probably damaging 0.99
IGL02389:Jakmip1 APN 5 37100843 nonsense probably null
R0036:Jakmip1 UTSW 5 37134304 missense probably null 0.38
R0194:Jakmip1 UTSW 5 37134283 missense possibly damaging 0.77
R0442:Jakmip1 UTSW 5 37135553 splice site probably null
R0555:Jakmip1 UTSW 5 37118873 missense probably damaging 0.99
R1053:Jakmip1 UTSW 5 37134249 missense possibly damaging 0.59
R1158:Jakmip1 UTSW 5 37091128 missense possibly damaging 0.94
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R2397:Jakmip1 UTSW 5 37100743 missense probably damaging 0.99
R2425:Jakmip1 UTSW 5 37141805 nonsense probably null
R2973:Jakmip1 UTSW 5 37091527 missense probably damaging 1.00
R4758:Jakmip1 UTSW 5 37128622 missense probably damaging 0.99
R4918:Jakmip1 UTSW 5 37091275 missense probably damaging 1.00
R5212:Jakmip1 UTSW 5 37104901 missense probably benign 0.05
R5842:Jakmip1 UTSW 5 37107268 missense probably damaging 1.00
R5926:Jakmip1 UTSW 5 37085280 unclassified probably benign
R6258:Jakmip1 UTSW 5 37141760 nonsense probably null
R6776:Jakmip1 UTSW 5 37187154 missense probably damaging 0.97
R6880:Jakmip1 UTSW 5 37105623 missense possibly damaging 0.95
R6961:Jakmip1 UTSW 5 37173353 missense probably damaging 0.98
R6982:Jakmip1 UTSW 5 37124941 missense probably damaging 1.00
R7109:Jakmip1 UTSW 5 37174765 nonsense probably null
R7173:Jakmip1 UTSW 5 37091364 missense probably damaging 1.00
R7293:Jakmip1 UTSW 5 37127473 missense probably benign 0.00
R7294:Jakmip1 UTSW 5 37117460 missense possibly damaging 0.65
R7361:Jakmip1 UTSW 5 37118804 missense probably damaging 1.00
R7384:Jakmip1 UTSW 5 37173207 missense possibly damaging 0.70
R7454:Jakmip1 UTSW 5 37175154 missense probably damaging 0.96
R7477:Jakmip1 UTSW 5 37173571 missense probably benign 0.00
R7579:Jakmip1 UTSW 5 37127458 missense possibly damaging 0.95
R7617:Jakmip1 UTSW 5 37171001 missense possibly damaging 0.85
R7651:Jakmip1 UTSW 5 37134273 missense probably damaging 0.97
R7702:Jakmip1 UTSW 5 37117497 missense probably damaging 1.00
R7822:Jakmip1 UTSW 5 37175180 missense probably damaging 0.99
R7888:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R7942:Jakmip1 UTSW 5 37173838 missense probably benign 0.01
R7949:Jakmip1 UTSW 5 37182148 missense probably damaging 1.00
R8015:Jakmip1 UTSW 5 37159765 missense unknown
R8039:Jakmip1 UTSW 5 37100772 missense probably damaging 1.00
R8044:Jakmip1 UTSW 5 37154644 missense unknown
R8070:Jakmip1 UTSW 5 37173287 missense probably benign 0.10
R8410:Jakmip1 UTSW 5 37117484 missense possibly damaging 0.91
RF014:Jakmip1 UTSW 5 37174526 missense possibly damaging 0.59
T0722:Jakmip1 UTSW 5 37118903 missense probably damaging 1.00
Z1088:Jakmip1 UTSW 5 37120986 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37091583 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37175307 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGAAACGTCCTCAAGGTTTGTC -3'
(R):5'- GCAGTCTTGACTTTGTCTGC -3'

Sequencing Primer
(F):5'- CTCAAGGTTTGTCTCTCCAGAG -3'
(R):5'- GACTTTGTCTGCGGCGC -3'
Posted On2014-10-30