Incidental Mutation 'R2383:Evx2'
ID247591
Institutional Source Beutler Lab
Gene Symbol Evx2
Ensembl Gene ENSMUSG00000001815
Gene Nameeven-skipped homeobox 2
SynonymsEvx-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R2383 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74652991-74659557 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 74658049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001867] [ENSMUST00000173623]
Predicted Effect probably null
Transcript: ENSMUST00000001867
SMART Domains Protein: ENSMUSP00000001867
Gene: ENSMUSG00000001815

DomainStartEndE-ValueType
low complexity region 82 97 N/A INTRINSIC
low complexity region 106 111 N/A INTRINSIC
low complexity region 146 187 N/A INTRINSIC
HOX 190 252 5.66e-26 SMART
low complexity region 296 312 N/A INTRINSIC
low complexity region 348 387 N/A INTRINSIC
low complexity region 396 433 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173623
SMART Domains Protein: ENSMUSP00000134131
Gene: ENSMUSG00000001815

DomainStartEndE-ValueType
low complexity region 83 98 N/A INTRINSIC
low complexity region 107 112 N/A INTRINSIC
low complexity region 147 188 N/A INTRINSIC
HOX 191 253 5.66e-26 SMART
low complexity region 297 313 N/A INTRINSIC
low complexity region 349 388 N/A INTRINSIC
low complexity region 397 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is located at the 5' end of the Hoxd gene cluster on chromosome 2. The encoded protein is a homeobox transcription factor that is related to the protein encoded by the Drosophila even-skipped (eve) gene, a member of the pair-rule class of segmentation genes. The encoded protein plays a role in limb morphogenesis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, male infertility, short limbs, and abnormalities in phalanx, carpal bone and metacarpal bone morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 T C 2: 131,051,362 T748A probably benign Het
Afg3l2 A G 18: 67,422,956 V435A possibly damaging Het
BC005561 T C 5: 104,518,988 S459P probably benign Het
BC048403 A G 10: 121,750,649 T290A possibly damaging Het
Ccdc170 G A 10: 4,534,208 E345K probably benign Het
Chd2 T C 7: 73,503,420 I227V possibly damaging Het
Cndp2 C A 18: 84,675,090 D182Y possibly damaging Het
Col14a1 A T 15: 55,447,517 probably benign Het
Cyp2e1 C T 7: 140,770,068 S222L probably benign Het
L1td1 A G 4: 98,737,722 E718G possibly damaging Het
Lgr4 T C 2: 110,000,615 S296P probably damaging Het
Lrrc7 T C 3: 158,163,956 M709V probably benign Het
Mtbp G A 15: 55,566,194 G162D probably damaging Het
Nap1l1 T G 10: 111,493,411 D295E probably damaging Het
Olfr38 A T 6: 42,762,459 M136L probably benign Het
Plrg1 C T 3: 83,065,948 P178S probably damaging Het
Serpina1b T A 12: 103,728,280 I402F probably benign Het
Sla T A 15: 66,782,676 I254F probably damaging Het
Slc25a29 A G 12: 108,827,008 S215P probably damaging Het
Tiam1 A G 16: 89,798,684 V1303A probably benign Het
Trim45 A T 3: 100,925,227 I259F probably damaging Het
Ttn T C 2: 76,706,512 S34990G probably benign Het
Zbtb48 A G 4: 152,026,950 V36A probably damaging Het
Other mutations in Evx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0133:Evx2 UTSW 2 74659082 missense possibly damaging 0.93
R0195:Evx2 UTSW 2 74659044 missense probably damaging 1.00
R0549:Evx2 UTSW 2 74659134 missense probably benign
R0610:Evx2 UTSW 2 74655987 missense probably benign 0.16
R0645:Evx2 UTSW 2 74657894 missense possibly damaging 0.81
R1608:Evx2 UTSW 2 74657851 missense probably damaging 1.00
R1769:Evx2 UTSW 2 74659157 missense probably benign 0.00
R2156:Evx2 UTSW 2 74656016 missense probably damaging 1.00
R4849:Evx2 UTSW 2 74659331 missense probably benign 0.34
R5407:Evx2 UTSW 2 74657826 missense probably damaging 1.00
R6167:Evx2 UTSW 2 74659262 missense probably damaging 0.96
R6704:Evx2 UTSW 2 74656155 missense probably damaging 1.00
R7447:Evx2 UTSW 2 74659104 missense probably benign 0.00
X0017:Evx2 UTSW 2 74657792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGTAGTTCTCCCTGTAGAAC -3'
(R):5'- TTTGGTTAGGAAGGGCTCCC -3'

Sequencing Primer
(F):5'- GTAGAACTCTTTCTCCAGGCG -3'
(R):5'- GGGCTCCCCAAACTTCATTG -3'
Posted On2014-11-11